Incidental Mutation 'R8237:Olfr494'
ID637413
Institutional Source Beutler Lab
Gene Symbol Olfr494
Ensembl Gene ENSMUSG00000109631
Gene Nameolfactory receptor 494
SynonymsMOR204-10, GA_x6K02T2PBJ9-10697517-10698461
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R8237 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location108365335-108368436 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 108368027 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 179 (H179P)
Ref Sequence ENSEMBL: ENSMUSP00000148063 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000209743
AA Change: H179P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000210291
AA Change: H179P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,880,547 L285P probably damaging Het
Abca4 T C 3: 122,162,303 I1905T probably benign Het
Abca5 A T 11: 110,310,155 I473K probably benign Het
Adgrl3 CAA CA 5: 81,787,561 probably null Het
Aim1 G A 10: 43,966,380 Q1772* probably null Het
Ap2a1 C A 7: 44,900,796 R959L probably damaging Het
Birc6 G C 17: 74,611,131 L1845F probably damaging Het
Cbs T C 17: 31,615,480 I512V probably benign Het
Ceacam3 T C 7: 17,163,157 Y683H Het
Chd8 C T 14: 52,213,352 S1426N probably damaging Het
Cog8 T C 8: 107,056,291 D122G probably benign Het
Cspg4 T C 9: 56,892,680 F1576S probably damaging Het
Ctse T A 1: 131,662,729 V63E probably benign Het
Dnah3 G T 7: 119,926,413 T3917N probably benign Het
Dst C T 1: 34,169,793 T1124M possibly damaging Het
Fkbp10 A G 11: 100,415,959 Q59R probably damaging Het
Fsip1 A G 2: 118,233,002 S329P probably damaging Het
Ginm1 G T 10: 7,792,655 S56R unknown Het
Gm10110 C T 14: 89,898,241 V76M noncoding transcript Het
Gm6401 T A 14: 41,965,495 I125F probably damaging Het
Helz2 T C 2: 181,229,331 D2815G possibly damaging Het
Hes1 T C 16: 30,067,229 V217A probably damaging Het
Hrasls C A 16: 29,220,354 T62K probably benign Het
Hsd3b1 C T 3: 98,853,110 M188I possibly damaging Het
Ighv1-75 T C 12: 115,834,256 probably benign Het
Kif1b T A 4: 149,191,185 N1423I probably benign Het
Lmntd1 G A 6: 145,427,420 T129M probably damaging Het
Lonrf2 T A 1: 38,800,773 T414S probably benign Het
Lrp1b T C 2: 40,851,774 D3161G Het
Lyst T C 13: 13,651,732 I1608T probably benign Het
Map9 C T 3: 82,377,160 P347L probably damaging Het
Mixl1 G A 1: 180,696,757 Q86* probably null Het
Muc5b T C 7: 141,857,960 S1548P unknown Het
Myo15b A G 11: 115,877,001 K1376E Het
Nlrc5 A G 8: 94,526,125 T105A unknown Het
Npepps A G 11: 97,248,200 probably null Het
Nup205 T A 6: 35,227,503 F1441L possibly damaging Het
Pbx4 A G 8: 69,864,443 T117A probably benign Het
Phf2 T A 13: 48,823,038 T234S unknown Het
Pik3r2 G A 8: 70,772,150 A194V probably benign Het
Plbd2 T C 5: 120,499,049 D116G probably damaging Het
Plpp2 G A 10: 79,527,460 A235V possibly damaging Het
Prkce G T 17: 86,559,218 R502L probably damaging Het
Psrc1 C T 3: 108,386,614 A249V probably damaging Het
Ptdss1 T C 13: 66,976,777 C347R probably damaging Het
Spcs1 C G 14: 31,000,701 A113P noncoding transcript Het
Ssfa2 T C 2: 79,657,270 S566P probably benign Het
Stxbp2 C T 8: 3,635,695 T247M Het
Tex15 A G 8: 33,577,399 T2286A possibly damaging Het
Usp45 T G 4: 21,834,274 V736G probably damaging Het
Vmn2r69 A G 7: 85,411,132 S415P probably benign Het
Wisp1 C A 15: 66,919,234 T295N probably benign Het
Zfp407 T C 18: 84,560,144 E948G possibly damaging Het
Zfp942 A T 17: 21,928,245 C468S possibly damaging Het
Zmym6 A G 4: 127,122,751 E775G probably damaging Het
Zranb2 A G 3: 157,545,040 R283G probably null Het
Other mutations in Olfr494
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Olfr494 APN 7 108368318 missense probably damaging 1.00
IGL01934:Olfr494 APN 7 108368161 missense probably damaging 0.99
IGL02041:Olfr494 APN 7 108367535 missense probably damaging 1.00
IGL02253:Olfr494 APN 7 108368054 missense possibly damaging 0.80
IGL02902:Olfr494 APN 7 108368129 missense probably damaging 1.00
R0125:Olfr494 UTSW 7 108368369 missense probably damaging 0.98
R0523:Olfr494 UTSW 7 108368231 missense probably damaging 1.00
R0650:Olfr494 UTSW 7 108367789 missense probably damaging 1.00
R1268:Olfr494 UTSW 7 108367795 missense probably benign 0.06
R2036:Olfr494 UTSW 7 108367740 missense probably benign 0.00
R2162:Olfr494 UTSW 7 108367562 missense probably benign 0.08
R2278:Olfr494 UTSW 7 108368081 missense probably benign 0.01
R2368:Olfr494 UTSW 7 108368369 missense probably damaging 0.98
R3410:Olfr494 UTSW 7 108368344 missense possibly damaging 0.52
R3411:Olfr494 UTSW 7 108368344 missense possibly damaging 0.52
R3834:Olfr494 UTSW 7 108368072 missense probably damaging 0.98
R4322:Olfr494 UTSW 7 108368348 missense probably damaging 1.00
R4625:Olfr494 UTSW 7 108367688 missense probably damaging 0.98
R4724:Olfr494 UTSW 7 108367998 missense probably benign
R4843:Olfr494 UTSW 7 108368143 missense probably benign 0.01
R5525:Olfr494 UTSW 7 108367999 missense probably benign
R5954:Olfr494 UTSW 7 108367601 missense probably damaging 0.98
R7027:Olfr494 UTSW 7 108368350 missense probably damaging 0.98
R8041:Olfr494 UTSW 7 108367534 missense probably damaging 1.00
Z1177:Olfr494 UTSW 7 108368261 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGACAGTTGAATGCTTTCTTC -3'
(R):5'- AGGTAGAGAAGGCCTTGTGTC -3'

Sequencing Primer
(F):5'- GCTGCCATGGCTTATGATCGC -3'
(R):5'- AGAAGGCCTTGTGTCTGCCC -3'
Posted On2020-07-13