Incidental Mutation 'R8237:Ginm1'
ID637423
Institutional Source Beutler Lab
Gene Symbol Ginm1
Ensembl Gene ENSMUSG00000040006
Gene Nameglycoprotein integral membrane 1
SynonymsBC013529
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8237 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location7767947-7792824 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 7792655 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 56 (S56R)
Ref Sequence ENSEMBL: ENSMUSP00000070236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015901] [ENSMUST00000065124] [ENSMUST00000143214]
Predicted Effect probably benign
Transcript: ENSMUST00000015901
SMART Domains Protein: ENSMUSP00000015901
Gene: ENSMUSG00000015757

DomainStartEndE-ValueType
Pfam:Pro_isomerase 2 161 6.4e-40 PFAM
low complexity region 205 218 N/A INTRINSIC
RRM 241 314 1.49e-22 SMART
low complexity region 321 333 N/A INTRINSIC
low complexity region 374 389 N/A INTRINSIC
low complexity region 435 449 N/A INTRINSIC
low complexity region 467 492 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000065124
AA Change: S56R
Predicted Effect probably benign
Transcript: ENSMUST00000143214
SMART Domains Protein: ENSMUSP00000119332
Gene: ENSMUSG00000015757

DomainStartEndE-ValueType
Pfam:Pro_isomerase 2 67 1.8e-18 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,880,547 L285P probably damaging Het
Abca4 T C 3: 122,162,303 I1905T probably benign Het
Abca5 A T 11: 110,310,155 I473K probably benign Het
Adgrl3 CAA CA 5: 81,787,561 probably null Het
Aim1 G A 10: 43,966,380 Q1772* probably null Het
Ap2a1 C A 7: 44,900,796 R959L probably damaging Het
Birc6 G C 17: 74,611,131 L1845F probably damaging Het
Cbs T C 17: 31,615,480 I512V probably benign Het
Ceacam3 T C 7: 17,163,157 Y683H Het
Chd8 C T 14: 52,213,352 S1426N probably damaging Het
Cog8 T C 8: 107,056,291 D122G probably benign Het
Cspg4 T C 9: 56,892,680 F1576S probably damaging Het
Ctse T A 1: 131,662,729 V63E probably benign Het
Dnah3 G T 7: 119,926,413 T3917N probably benign Het
Dst C T 1: 34,169,793 T1124M possibly damaging Het
Fkbp10 A G 11: 100,415,959 Q59R probably damaging Het
Fsip1 A G 2: 118,233,002 S329P probably damaging Het
Gm10110 C T 14: 89,898,241 V76M noncoding transcript Het
Gm6401 T A 14: 41,965,495 I125F probably damaging Het
Helz2 T C 2: 181,229,331 D2815G possibly damaging Het
Hes1 T C 16: 30,067,229 V217A probably damaging Het
Hrasls C A 16: 29,220,354 T62K probably benign Het
Hsd3b1 C T 3: 98,853,110 M188I possibly damaging Het
Ighv1-75 T C 12: 115,834,256 probably benign Het
Kif1b T A 4: 149,191,185 N1423I probably benign Het
Lmntd1 G A 6: 145,427,420 T129M probably damaging Het
Lonrf2 T A 1: 38,800,773 T414S probably benign Het
Lrp1b T C 2: 40,851,774 D3161G Het
Lyst T C 13: 13,651,732 I1608T probably benign Het
Map9 C T 3: 82,377,160 P347L probably damaging Het
Mixl1 G A 1: 180,696,757 Q86* probably null Het
Muc5b T C 7: 141,857,960 S1548P unknown Het
Myo15b A G 11: 115,877,001 K1376E Het
Nlrc5 A G 8: 94,526,125 T105A unknown Het
Npepps A G 11: 97,248,200 probably null Het
Nup205 T A 6: 35,227,503 F1441L possibly damaging Het
Olfr494 A C 7: 108,368,027 H179P probably damaging Het
Pbx4 A G 8: 69,864,443 T117A probably benign Het
Phf2 T A 13: 48,823,038 T234S unknown Het
Pik3r2 G A 8: 70,772,150 A194V probably benign Het
Plbd2 T C 5: 120,499,049 D116G probably damaging Het
Plpp2 G A 10: 79,527,460 A235V possibly damaging Het
Prkce G T 17: 86,559,218 R502L probably damaging Het
Psrc1 C T 3: 108,386,614 A249V probably damaging Het
Ptdss1 T C 13: 66,976,777 C347R probably damaging Het
Spcs1 C G 14: 31,000,701 A113P noncoding transcript Het
Ssfa2 T C 2: 79,657,270 S566P probably benign Het
Stxbp2 C T 8: 3,635,695 T247M Het
Tex15 A G 8: 33,577,399 T2286A possibly damaging Het
Usp45 T G 4: 21,834,274 V736G probably damaging Het
Vmn2r69 A G 7: 85,411,132 S415P probably benign Het
Wisp1 C A 15: 66,919,234 T295N probably benign Het
Zfp407 T C 18: 84,560,144 E948G possibly damaging Het
Zfp942 A T 17: 21,928,245 C468S possibly damaging Het
Zmym6 A G 4: 127,122,751 E775G probably damaging Het
Zranb2 A G 3: 157,545,040 R283G probably null Het
Other mutations in Ginm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Ginm1 APN 10 7792696 unclassified probably benign
IGL02474:Ginm1 APN 10 7777768 splice site probably benign
IGL02606:Ginm1 APN 10 7770399 missense probably damaging 0.98
R0010:Ginm1 UTSW 10 7775374 splice site probably benign
R0010:Ginm1 UTSW 10 7775374 splice site probably benign
R0052:Ginm1 UTSW 10 7779306 missense possibly damaging 0.92
R0052:Ginm1 UTSW 10 7779306 missense possibly damaging 0.92
R1901:Ginm1 UTSW 10 7775216 critical splice donor site probably null
R2106:Ginm1 UTSW 10 7775326 missense probably damaging 1.00
R5374:Ginm1 UTSW 10 7779314 missense probably damaging 0.99
R5929:Ginm1 UTSW 10 7774050 missense probably benign 0.16
R6062:Ginm1 UTSW 10 7775333 missense probably benign 0.00
R6102:Ginm1 UTSW 10 7768496 missense probably benign 0.00
R6792:Ginm1 UTSW 10 7773983 missense probably damaging 1.00
R7326:Ginm1 UTSW 10 7777850 nonsense probably null
R7417:Ginm1 UTSW 10 7774080 missense probably damaging 0.99
R7663:Ginm1 UTSW 10 7775362 missense possibly damaging 0.84
R7757:Ginm1 UTSW 10 7779355 missense probably damaging 1.00
R8437:Ginm1 UTSW 10 7770366 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAACCAAAGCTTGTTAGTCACC -3'
(R):5'- CAGAGTGGTCTCCAAGAGAACC -3'

Sequencing Primer
(F):5'- AACCAAAGCTTGTTAGTCACCTTTTC -3'
(R):5'- CAATGACAGGCGCATGC -3'
Posted On2020-07-13