Incidental Mutation 'R8237:Plpp2'
ID637425
Institutional Source Beutler Lab
Gene Symbol Plpp2
Ensembl Gene ENSMUSG00000052151
Gene Namephospholipid phosphatase 2
SynonymsLpp2, Ppap2c
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8237 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location79526430-79533796 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 79527460 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 235 (A235V)
Ref Sequence ENSEMBL: ENSMUSP00000069670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063879] [ENSMUST00000165233] [ENSMUST00000166804]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063879
AA Change: A235V

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000069670
Gene: ENSMUSG00000052151
AA Change: A235V

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
Blast:acidPPc 21 70 6e-9 BLAST
acidPPc 99 239 1.42e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165233
SMART Domains Protein: ENSMUSP00000127000
Gene: ENSMUSG00000052151

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166804
AA Change: A179V

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133247
Gene: ENSMUSG00000052151
AA Change: A179V

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
acidPPc 43 183 1.42e-41 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a lipid phosphate phosphohydrolase. It is an integral membrane protein that catalyzes the conversion of phosphatidic acid to diacylglycerol and inorganic phosphate. The transcript is expressed at high levels in lung, liver, and kidney and at low levels in brain and heart. Null mutant mice are viable and fertile and display no overt phenotypic defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,880,547 L285P probably damaging Het
Abca4 T C 3: 122,162,303 I1905T probably benign Het
Abca5 A T 11: 110,310,155 I473K probably benign Het
Adgrl3 CAA CA 5: 81,787,561 probably null Het
Aim1 G A 10: 43,966,380 Q1772* probably null Het
Ap2a1 C A 7: 44,900,796 R959L probably damaging Het
Birc6 G C 17: 74,611,131 L1845F probably damaging Het
Cbs T C 17: 31,615,480 I512V probably benign Het
Ceacam3 T C 7: 17,163,157 Y683H Het
Chd8 C T 14: 52,213,352 S1426N probably damaging Het
Cog8 T C 8: 107,056,291 D122G probably benign Het
Cspg4 T C 9: 56,892,680 F1576S probably damaging Het
Ctse T A 1: 131,662,729 V63E probably benign Het
Dnah3 G T 7: 119,926,413 T3917N probably benign Het
Dst C T 1: 34,169,793 T1124M possibly damaging Het
Fkbp10 A G 11: 100,415,959 Q59R probably damaging Het
Fsip1 A G 2: 118,233,002 S329P probably damaging Het
Ginm1 G T 10: 7,792,655 S56R unknown Het
Gm10110 C T 14: 89,898,241 V76M noncoding transcript Het
Gm6401 T A 14: 41,965,495 I125F probably damaging Het
Helz2 T C 2: 181,229,331 D2815G possibly damaging Het
Hes1 T C 16: 30,067,229 V217A probably damaging Het
Hrasls C A 16: 29,220,354 T62K probably benign Het
Hsd3b1 C T 3: 98,853,110 M188I possibly damaging Het
Ighv1-75 T C 12: 115,834,256 probably benign Het
Kif1b T A 4: 149,191,185 N1423I probably benign Het
Lmntd1 G A 6: 145,427,420 T129M probably damaging Het
Lonrf2 T A 1: 38,800,773 T414S probably benign Het
Lrp1b T C 2: 40,851,774 D3161G Het
Lyst T C 13: 13,651,732 I1608T probably benign Het
Map9 C T 3: 82,377,160 P347L probably damaging Het
Mixl1 G A 1: 180,696,757 Q86* probably null Het
Muc5b T C 7: 141,857,960 S1548P unknown Het
Myo15b A G 11: 115,877,001 K1376E Het
Nlrc5 A G 8: 94,526,125 T105A unknown Het
Npepps A G 11: 97,248,200 probably null Het
Nup205 T A 6: 35,227,503 F1441L possibly damaging Het
Olfr494 A C 7: 108,368,027 H179P probably damaging Het
Pbx4 A G 8: 69,864,443 T117A probably benign Het
Phf2 T A 13: 48,823,038 T234S unknown Het
Pik3r2 G A 8: 70,772,150 A194V probably benign Het
Plbd2 T C 5: 120,499,049 D116G probably damaging Het
Prkce G T 17: 86,559,218 R502L probably damaging Het
Psrc1 C T 3: 108,386,614 A249V probably damaging Het
Ptdss1 T C 13: 66,976,777 C347R probably damaging Het
Spcs1 C G 14: 31,000,701 A113P noncoding transcript Het
Ssfa2 T C 2: 79,657,270 S566P probably benign Het
Stxbp2 C T 8: 3,635,695 T247M Het
Tex15 A G 8: 33,577,399 T2286A possibly damaging Het
Usp45 T G 4: 21,834,274 V736G probably damaging Het
Vmn2r69 A G 7: 85,411,132 S415P probably benign Het
Wisp1 C A 15: 66,919,234 T295N probably benign Het
Zfp407 T C 18: 84,560,144 E948G possibly damaging Het
Zfp942 A T 17: 21,928,245 C468S possibly damaging Het
Zmym6 A G 4: 127,122,751 E775G probably damaging Het
Zranb2 A G 3: 157,545,040 R283G probably null Het
Other mutations in Plpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01321:Plpp2 APN 10 79527493 missense probably damaging 1.00
IGL03327:Plpp2 APN 10 79530984 splice site probably null
Trust UTSW 10 79530929 missense probably damaging 1.00
R0009:Plpp2 UTSW 10 79527244 missense probably benign 0.01
R0056:Plpp2 UTSW 10 79527229 missense probably damaging 0.99
R0097:Plpp2 UTSW 10 79530537 missense possibly damaging 0.50
R0311:Plpp2 UTSW 10 79527580 missense probably damaging 0.97
R0840:Plpp2 UTSW 10 79527544 missense probably benign 0.16
R1406:Plpp2 UTSW 10 79530777 splice site probably benign
R1642:Plpp2 UTSW 10 79530684 missense probably damaging 1.00
R3436:Plpp2 UTSW 10 79527813 critical splice donor site probably null
R3437:Plpp2 UTSW 10 79527813 critical splice donor site probably null
R4400:Plpp2 UTSW 10 79527493 missense possibly damaging 0.88
R4521:Plpp2 UTSW 10 79530625 missense probably damaging 1.00
R4873:Plpp2 UTSW 10 79530929 missense probably damaging 1.00
R4875:Plpp2 UTSW 10 79530929 missense probably damaging 1.00
R5114:Plpp2 UTSW 10 79527139 missense probably benign 0.41
R6970:Plpp2 UTSW 10 79530546 missense possibly damaging 0.90
R7383:Plpp2 UTSW 10 79531007 missense probably null 0.99
R7902:Plpp2 UTSW 10 79527544 missense possibly damaging 0.91
R7953:Plpp2 UTSW 10 79530540 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AATCTGAAACATAGCGGACCTGG -3'
(R):5'- ACAGCTATATGTGCAGGCC -3'

Sequencing Primer
(F):5'- CATAGCGGACCTGGGGAGG -3'
(R):5'- TATATGTGCAGGCCCGGCTC -3'
Posted On2020-07-13