Incidental Mutation 'R0726:Soga1'
ID63744
Institutional Source Beutler Lab
Gene Symbol Soga1
Ensembl Gene ENSMUSG00000055485
Gene Namesuppressor of glucose, autophagy associated 1
SynonymsD430036N24Rik, 9830001H06Rik
MMRRC Submission 038908-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R0726 (G1)
Quality Score96
Status Validated
Chromosome2
Chromosomal Location157015799-157079254 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 157060262 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 278 (R278S)
Ref Sequence ENSEMBL: ENSMUSP00000066556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069098]
Predicted Effect probably damaging
Transcript: ENSMUST00000069098
AA Change: R278S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066556
Gene: ENSMUSG00000055485
AA Change: R278S

DomainStartEndE-ValueType
low complexity region 15 23 N/A INTRINSIC
low complexity region 51 66 N/A INTRINSIC
low complexity region 97 112 N/A INTRINSIC
low complexity region 132 148 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
Blast:BRLZ 212 246 4e-8 BLAST
SCOP:d1fxkc_ 216 350 1e-3 SMART
Pfam:DUF3166 378 472 2.3e-31 PFAM
Pfam:DUF3166 504 593 5.3e-31 PFAM
low complexity region 637 649 N/A INTRINSIC
coiled coil region 807 867 N/A INTRINSIC
low complexity region 872 884 N/A INTRINSIC
low complexity region 938 950 N/A INTRINSIC
Pfam:DUF4482 1065 1205 3.9e-28 PFAM
low complexity region 1311 1321 N/A INTRINSIC
low complexity region 1363 1377 N/A INTRINSIC
low complexity region 1389 1418 N/A INTRINSIC
Meta Mutation Damage Score 0.0692 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.1%
  • 20x: 89.2%
Validation Efficiency 98% (90/92)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg12 T C 15: 88,806,647 Y256C probably damaging Het
Alox15 T A 11: 70,350,195 D160V probably damaging Het
Aox2 T C 1: 58,334,782 probably benign Het
Bbs9 G T 9: 22,793,823 A729S probably damaging Het
Bmp2k T A 5: 97,087,494 probably benign Het
Braf C T 6: 39,662,148 R223Q possibly damaging Het
Cd101 A T 3: 101,020,622 S48T possibly damaging Het
Cdh9 T G 15: 16,831,044 D322E probably benign Het
Col28a1 C T 6: 8,014,495 probably null Het
Cpxm1 G A 2: 130,390,939 R712W probably damaging Het
Csnk1g1 T C 9: 66,032,355 probably benign Het
Cyp2d37-ps A C 15: 82,690,449 noncoding transcript Het
Cyth3 T C 5: 143,692,642 V115A probably benign Het
Dnah9 C T 11: 65,965,681 V2885M probably damaging Het
Dock9 G T 14: 121,651,768 Y326* probably null Het
Espl1 T C 15: 102,322,598 I1844T probably benign Het
Fam105a A T 15: 27,656,947 I338N probably damaging Het
Fam20a T A 11: 109,677,194 N357Y probably damaging Het
Fancc C A 13: 63,323,411 R385L probably benign Het
Foxe3 A T 4: 114,925,250 L255H unknown Het
Frem2 T C 3: 53,519,626 D2967G possibly damaging Het
Gabra6 T G 11: 42,315,127 T301P probably damaging Het
Ganab T A 19: 8,911,113 Y511N probably damaging Het
Gm498 A G 7: 143,871,761 D49G probably damaging Het
Grm4 T A 17: 27,438,438 probably benign Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Kcnj9 G A 1: 172,325,921 S212F probably damaging Het
Kif15 C A 9: 122,959,928 H62N probably benign Het
Kptn A G 7: 16,120,722 D106G probably damaging Het
Krtap13-1 T A 16: 88,729,304 S139T probably damaging Het
Lepr C A 4: 101,764,934 N354K probably benign Het
Lypd3 G T 7: 24,638,544 E112* probably null Het
Med13l A T 5: 118,748,684 N1550I probably damaging Het
Mettl2 C T 11: 105,126,844 P60L probably benign Het
Muc4 A G 16: 32,769,827 E850G probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Nek1 A G 8: 61,089,592 R739G probably damaging Het
Nipbl A T 15: 8,351,555 D584E probably benign Het
Nkain3 C T 4: 20,158,388 V162M possibly damaging Het
Nmrk1 T C 19: 18,641,480 probably benign Het
Nsd2 T C 5: 33,861,028 probably benign Het
Olfr1198 A T 2: 88,746,008 N293K probably benign Het
Olfr1270 T A 2: 90,149,283 H241L probably damaging Het
Olfr133 T C 17: 38,148,624 F12S probably damaging Het
Olfr1449 T A 19: 12,935,605 V289D probably damaging Het
Olfr907 T A 9: 38,499,122 M151K possibly damaging Het
Phex T A X: 157,372,561 probably benign Het
Pip5k1b G T 19: 24,378,892 D227E probably damaging Het
Prdm13 A G 4: 21,683,914 I119T unknown Het
Rab19 G T 6: 39,383,959 V14L probably benign Het
Rasa3 A G 8: 13,580,118 probably benign Het
Rgsl1 C T 1: 153,802,328 S118N probably damaging Het
Rif1 C T 2: 52,110,353 T1273M possibly damaging Het
Scn8a A G 15: 100,972,830 N254S probably damaging Het
Sema6a T C 18: 47,291,981 T188A probably damaging Het
Sh3pxd2a C T 19: 47,268,762 E506K probably damaging Het
Smarca2 A T 19: 26,698,403 K1014N probably damaging Het
Smarca4 T G 9: 21,700,139 probably null Het
Sntb1 T C 15: 55,676,356 R361G probably benign Het
Stx5a T A 19: 8,754,911 I208N probably damaging Het
Tas2r102 T A 6: 132,762,452 W108R probably damaging Het
Tcl1 A G 12: 105,218,670 Y94H probably damaging Het
Tenm3 T A 8: 48,236,594 Y1986F probably damaging Het
Tet2 G A 3: 133,468,184 P1439L probably benign Het
Tiam2 T C 17: 3,512,833 probably benign Het
Ubap2l G A 3: 90,021,246 T526M probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uhrf1bp1 T C 17: 27,885,489 V503A possibly damaging Het
Ushbp1 T A 8: 71,388,747 probably benign Het
Usp28 C T 9: 49,003,869 R115C probably damaging Het
Vldlr A T 19: 27,238,386 D261V probably damaging Het
Vmn2r5 C T 3: 64,503,765 D461N probably benign Het
Vmn2r86 A T 10: 130,446,396 F784I probably damaging Het
Zfp59 A T 7: 27,854,088 I322F probably damaging Het
Zfp607a A T 7: 27,879,149 H548L probably benign Het
Zfp626 G A 7: 27,818,623 C343Y probably damaging Het
Other mutations in Soga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Soga1 APN 2 157030864 missense probably damaging 1.00
IGL00924:Soga1 APN 2 157040705 missense probably damaging 0.99
IGL01723:Soga1 APN 2 157030614 missense probably benign 0.00
IGL01749:Soga1 APN 2 157021541 splice site probably benign
IGL02199:Soga1 APN 2 157030945 missense probably damaging 1.00
IGL02262:Soga1 APN 2 157030906 missense probably damaging 1.00
IGL02618:Soga1 APN 2 157040566 missense probably damaging 1.00
IGL02643:Soga1 APN 2 157040743 missense probably damaging 1.00
deglutition UTSW 2 157039864 missense possibly damaging 0.63
gulp UTSW 2 157023817 nonsense probably null
IGL02835:Soga1 UTSW 2 157041934 missense possibly damaging 0.91
R0528:Soga1 UTSW 2 157020692 missense probably damaging 1.00
R0535:Soga1 UTSW 2 157033289 missense possibly damaging 0.89
R1473:Soga1 UTSW 2 157020448 nonsense probably null
R1589:Soga1 UTSW 2 157027637 missense probably benign 0.05
R1615:Soga1 UTSW 2 157020743 missense probably damaging 1.00
R1681:Soga1 UTSW 2 157030530 missense possibly damaging 0.70
R1701:Soga1 UTSW 2 157030619 missense probably damaging 1.00
R1872:Soga1 UTSW 2 157040261 missense possibly damaging 0.88
R2056:Soga1 UTSW 2 157022827 missense probably benign 0.00
R2118:Soga1 UTSW 2 157033325 missense probably damaging 1.00
R2120:Soga1 UTSW 2 157033325 missense probably damaging 1.00
R2121:Soga1 UTSW 2 157033325 missense probably damaging 1.00
R2124:Soga1 UTSW 2 157033325 missense probably damaging 1.00
R2249:Soga1 UTSW 2 157040093 missense probably benign 0.08
R3147:Soga1 UTSW 2 157020364 missense possibly damaging 0.91
R3758:Soga1 UTSW 2 157020638 missense possibly damaging 0.77
R4601:Soga1 UTSW 2 157039924 missense probably benign 0.41
R4646:Soga1 UTSW 2 157020506 missense probably damaging 1.00
R4653:Soga1 UTSW 2 157040591 missense probably damaging 1.00
R4736:Soga1 UTSW 2 157020554 missense probably damaging 1.00
R4773:Soga1 UTSW 2 157030569 missense probably benign 0.08
R4796:Soga1 UTSW 2 157020252 missense probably benign
R4999:Soga1 UTSW 2 157022856 missense probably benign 0.10
R5304:Soga1 UTSW 2 157023817 nonsense probably null
R5369:Soga1 UTSW 2 157040734 missense probably damaging 1.00
R5530:Soga1 UTSW 2 157020342 missense probably damaging 1.00
R5712:Soga1 UTSW 2 157030921 missense probably damaging 1.00
R5780:Soga1 UTSW 2 157018490 missense probably damaging 0.98
R6162:Soga1 UTSW 2 157039864 missense possibly damaging 0.63
R6253:Soga1 UTSW 2 157021419 missense probably benign 0.00
R6303:Soga1 UTSW 2 157040764 missense possibly damaging 0.91
R6304:Soga1 UTSW 2 157040764 missense possibly damaging 0.91
R6523:Soga1 UTSW 2 157060343 nonsense probably null
R7216:Soga1 UTSW 2 157018370 missense possibly damaging 0.76
R7335:Soga1 UTSW 2 157031005 missense possibly damaging 0.86
R7562:Soga1 UTSW 2 157053589 missense probably damaging 1.00
R7593:Soga1 UTSW 2 157040856 missense probably benign 0.40
R7788:Soga1 UTSW 2 157027584 missense probably benign 0.09
R8013:Soga1 UTSW 2 157030786 critical splice donor site probably null
R8263:Soga1 UTSW 2 157027590 missense possibly damaging 0.94
R8299:Soga1 UTSW 2 157020731 missense possibly damaging 0.93
X0019:Soga1 UTSW 2 157020264 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGAAACGGCCTCTTGCTGCTTC -3'
(R):5'- ACCTGCACAACCTGTCAGTATTTCC -3'

Sequencing Primer
(F):5'- ttgaagatggaaaaactgaggc -3'
(R):5'- acccttctcttagtctcgtttg -3'
Posted On2013-07-30