Incidental Mutation 'R8238:Gm10799'
ID637451
Institutional Source Beutler Lab
Gene Symbol Gm10799
Ensembl Gene ENSMUSG00000075006
Gene Namepredicted gene 10799
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R8238 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location104068047-104068550 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104068151 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 70 (F70L)
Ref Sequence ENSEMBL: ENSMUSP00000097259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028603] [ENSMUST00000090429] [ENSMUST00000099666] [ENSMUST00000104891] [ENSMUST00000111130] [ENSMUST00000111131] [ENSMUST00000111132] [ENSMUST00000129749]
Predicted Effect probably benign
Transcript: ENSMUST00000028603
SMART Domains Protein: ENSMUSP00000028603
Gene: ENSMUSG00000027180

DomainStartEndE-ValueType
FBOX 16 56 2.83e-4 SMART
SMI1_KNR4 121 251 3.02e-5 SMART
Pfam:DUF525 294 384 3.1e-30 PFAM
coiled coil region 417 446 N/A INTRINSIC
low complexity region 462 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090429
SMART Domains Protein: ENSMUSP00000087912
Gene: ENSMUSG00000068686

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LU 24 104 1.88e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099666
AA Change: F70L

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097259
Gene: ENSMUSG00000075006
AA Change: F70L

DomainStartEndE-ValueType
low complexity region 86 99 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000104891
SMART Domains Protein: ENSMUSP00000100487
Gene: ENSMUSG00000078091

DomainStartEndE-ValueType
low complexity region 87 100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111130
SMART Domains Protein: ENSMUSP00000106760
Gene: ENSMUSG00000068686

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LU 24 104 1.88e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111131
SMART Domains Protein: ENSMUSP00000106761
Gene: ENSMUSG00000068686

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UPAR_LY6 26 84 1.1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111132
SMART Domains Protein: ENSMUSP00000106762
Gene: ENSMUSG00000068686

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UPAR_LY6 26 55 1.2e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129749
SMART Domains Protein: ENSMUSP00000117553
Gene: ENSMUSG00000068686

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LU 24 104 1.88e-19 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 A G 8: 43,650,956 Y551H probably damaging Het
Ak1 T A 2: 32,633,669 V198D probably damaging Het
Alx1 C T 10: 103,022,215 D208N possibly damaging Het
Atp5b T A 10: 128,085,150 I182N possibly damaging Het
Cabp5 T A 7: 13,405,452 M134K probably damaging Het
Camsap2 A T 1: 136,294,026 I227N probably benign Het
Cfap44 G A 16: 44,415,305 probably null Het
Dpyd G A 3: 119,195,193 probably null Het
Etl4 C T 2: 20,806,531 R1510* probably null Het
Fgr C T 4: 132,997,521 A311V probably damaging Het
Glipr1 C T 10: 111,993,440 probably null Het
Gm14412 A T 2: 177,315,318 H261Q unknown Het
Hey2 T A 10: 30,840,663 M35L probably benign Het
Hspb7 A G 4: 141,422,546 Y81C probably damaging Het
Ipo5 A T 14: 120,935,240 K570M probably damaging Het
Iqsec1 A T 6: 90,689,930 H404Q probably benign Het
Kif5b T A 18: 6,227,619 Q86L probably damaging Het
Lrrtm4 T A 6: 80,022,685 I360N probably damaging Het
Mup6 T A 4: 60,003,634 V29E probably damaging Het
Ncstn G T 1: 172,072,476 A277E probably damaging Het
Nsun3 A G 16: 62,770,713 V189A probably damaging Het
Oaf C T 9: 43,239,345 D77N probably damaging Het
Olfr545 T C 7: 102,494,620 T52A possibly damaging Het
Olfr60 A C 7: 140,345,890 L33W probably damaging Het
Pard6a A G 8: 105,702,734 D138G probably damaging Het
Ppp4r4 A C 12: 103,590,807 H434P probably benign Het
Sec23b T C 2: 144,564,648 I121T probably benign Het
Slc36a3 C T 11: 55,131,607 V254I probably benign Het
Slc7a14 C A 3: 31,227,151 V337L probably benign Het
Svs1 A G 6: 48,990,041 E641G probably damaging Het
Tdh C T 14: 63,495,724 G206E probably damaging Het
Vmn1r231 T C 17: 20,890,378 T92A probably benign Het
Vmn2r36 T G 7: 7,889,016 H431P probably benign Het
Vmn2r92 G T 17: 18,185,016 M807I probably benign Het
Vps11 T C 9: 44,352,760 T759A probably benign Het
Xdh G T 17: 73,886,417 Q1295K probably benign Het
Other mutations in Gm10799
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4408:Gm10799 UTSW 2 104068064 missense possibly damaging 0.81
R4884:Gm10799 UTSW 2 104068207 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGCTGTCCTGATGAGAGAG -3'
(R):5'- AGAGGACTTTCCATCTCCCCAC -3'

Sequencing Primer
(F):5'- CTGTCCTGATGAGAGAGAGCTG -3'
(R):5'- CCATTTACAGGGTGAAAGCTGTG -3'
Posted On2020-07-13