Incidental Mutation 'R8238:Slc7a14'
ID637454
Institutional Source Beutler Lab
Gene Symbol Slc7a14
Ensembl Gene ENSMUSG00000069072
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 14
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R8238 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location31202858-31310378 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 31227151 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 337 (V337L)
Ref Sequence ENSEMBL: ENSMUSP00000088803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091259] [ENSMUST00000108245]
Predicted Effect probably benign
Transcript: ENSMUST00000091259
AA Change: V337L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000088803
Gene: ENSMUSG00000069072
AA Change: V337L

DomainStartEndE-ValueType
Pfam:AA_permease_2 53 443 2.1e-44 PFAM
Pfam:AA_permease 57 436 7.2e-38 PFAM
transmembrane domain 563 585 N/A INTRINSIC
transmembrane domain 595 617 N/A INTRINSIC
Pfam:AA_permease_C 627 677 9.2e-21 PFAM
low complexity region 737 757 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108245
AA Change: V337L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000103880
Gene: ENSMUSG00000069072
AA Change: V337L

DomainStartEndE-ValueType
Pfam:AA_permease_2 53 445 2.5e-46 PFAM
Pfam:AA_permease 57 437 6.9e-41 PFAM
transmembrane domain 563 585 N/A INTRINSIC
transmembrane domain 595 617 N/A INTRINSIC
Pfam:AA_permease_C 627 668 1.4e-17 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predicted to encode a glycosylated, cationic amino acid transporter protein with 14 transmembrane domains. This gene is primarily expressed in skin fibroblasts, neural tissue, and primary endothelial cells and its protein is predicted to mediate lysosomal uptake of cationic amino acids. Mutations in this gene are associated with autosomal recessive retinitis pigmentosa. In mice, this gene is expressed in the photoreceptor layer of the retina where its expression increases over the course of retinal development and persists in the mature retina. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal eye electrophysiology, thin retinal outer nuclear and decreased total retinal thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 A G 8: 43,650,956 Y551H probably damaging Het
Ak1 T A 2: 32,633,669 V198D probably damaging Het
Alx1 C T 10: 103,022,215 D208N possibly damaging Het
Atp5b T A 10: 128,085,150 I182N possibly damaging Het
Cabp5 T A 7: 13,405,452 M134K probably damaging Het
Camsap2 A T 1: 136,294,026 I227N probably benign Het
Cfap44 G A 16: 44,415,305 probably null Het
Dpyd G A 3: 119,195,193 probably null Het
Etl4 C T 2: 20,806,531 R1510* probably null Het
Fgr C T 4: 132,997,521 A311V probably damaging Het
Glipr1 C T 10: 111,993,440 probably null Het
Gm10799 A G 2: 104,068,151 F70L probably benign Het
Gm14412 A T 2: 177,315,318 H261Q unknown Het
Hey2 T A 10: 30,840,663 M35L probably benign Het
Hspb7 A G 4: 141,422,546 Y81C probably damaging Het
Ipo5 A T 14: 120,935,240 K570M probably damaging Het
Iqsec1 A T 6: 90,689,930 H404Q probably benign Het
Kif5b T A 18: 6,227,619 Q86L probably damaging Het
Lrrtm4 T A 6: 80,022,685 I360N probably damaging Het
Mup6 T A 4: 60,003,634 V29E probably damaging Het
Ncstn G T 1: 172,072,476 A277E probably damaging Het
Nsun3 A G 16: 62,770,713 V189A probably damaging Het
Oaf C T 9: 43,239,345 D77N probably damaging Het
Olfr545 T C 7: 102,494,620 T52A possibly damaging Het
Olfr60 A C 7: 140,345,890 L33W probably damaging Het
Pard6a A G 8: 105,702,734 D138G probably damaging Het
Ppp4r4 A C 12: 103,590,807 H434P probably benign Het
Sec23b T C 2: 144,564,648 I121T probably benign Het
Slc36a3 C T 11: 55,131,607 V254I probably benign Het
Svs1 A G 6: 48,990,041 E641G probably damaging Het
Tdh C T 14: 63,495,724 G206E probably damaging Het
Vmn1r231 T C 17: 20,890,378 T92A probably benign Het
Vmn2r36 T G 7: 7,889,016 H431P probably benign Het
Vmn2r92 G T 17: 18,185,016 M807I probably benign Het
Vps11 T C 9: 44,352,760 T759A probably benign Het
Xdh G T 17: 73,886,417 Q1295K probably benign Het
Other mutations in Slc7a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02631:Slc7a14 APN 3 31238678 missense probably damaging 1.00
IGL02713:Slc7a14 APN 3 31257763 missense probably damaging 0.96
IGL03341:Slc7a14 APN 3 31238770 missense probably damaging 1.00
IGL03350:Slc7a14 APN 3 31237409 missense probably benign 0.35
IGL03379:Slc7a14 APN 3 31223515 missense probably damaging 1.00
R0064:Slc7a14 UTSW 3 31227060 missense probably damaging 1.00
R1549:Slc7a14 UTSW 3 31224118 missense possibly damaging 0.94
R1591:Slc7a14 UTSW 3 31237449 missense probably damaging 1.00
R2054:Slc7a14 UTSW 3 31237362 splice site probably benign
R2057:Slc7a14 UTSW 3 31237496 missense probably damaging 1.00
R2442:Slc7a14 UTSW 3 31230320 missense probably damaging 1.00
R2504:Slc7a14 UTSW 3 31237501 missense possibly damaging 0.85
R3848:Slc7a14 UTSW 3 31237474 missense probably damaging 1.00
R4653:Slc7a14 UTSW 3 31257682 missense probably damaging 1.00
R4702:Slc7a14 UTSW 3 31230398 missense probably damaging 1.00
R5043:Slc7a14 UTSW 3 31237466 missense probably damaging 1.00
R5187:Slc7a14 UTSW 3 31237365 splice site probably null
R5345:Slc7a14 UTSW 3 31223857 missense probably damaging 0.99
R5393:Slc7a14 UTSW 3 31257770 missense probably damaging 1.00
R5421:Slc7a14 UTSW 3 31224197 missense probably damaging 1.00
R5736:Slc7a14 UTSW 3 31223910 missense probably benign 0.00
R5771:Slc7a14 UTSW 3 31238707 missense probably damaging 1.00
R5896:Slc7a14 UTSW 3 31257570 missense probably damaging 1.00
R5996:Slc7a14 UTSW 3 31209236 missense probably benign
R6020:Slc7a14 UTSW 3 31224112 missense probably benign
R6107:Slc7a14 UTSW 3 31257610 missense probably damaging 1.00
R6140:Slc7a14 UTSW 3 31237548 missense probably benign
R6491:Slc7a14 UTSW 3 31223944 missense probably damaging 1.00
R6846:Slc7a14 UTSW 3 31224223 missense probably damaging 1.00
R6990:Slc7a14 UTSW 3 31223579 missense possibly damaging 0.90
R7184:Slc7a14 UTSW 3 31227063 missense probably damaging 0.98
R7271:Slc7a14 UTSW 3 31224235 missense probably damaging 1.00
R7282:Slc7a14 UTSW 3 31227153 missense possibly damaging 0.67
R7331:Slc7a14 UTSW 3 31257731 missense probably benign 0.00
R8227:Slc7a14 UTSW 3 31209212 missense probably benign 0.00
R8524:Slc7a14 UTSW 3 31224133 missense possibly damaging 0.70
R8843:Slc7a14 UTSW 3 31257610 missense probably damaging 1.00
R8903:Slc7a14 UTSW 3 31223446 missense probably damaging 0.98
Z1088:Slc7a14 UTSW 3 31223999 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CCAGACTTTGGCAAGATTCTG -3'
(R):5'- AGACTACCATGCAAGCCTG -3'

Sequencing Primer
(F):5'- TCTTTAGGAAAGGCAGTCACC -3'
(R):5'- ACCATGCAAGCCTGTTTCCAG -3'
Posted On2020-07-13