Incidental Mutation 'R8238:Svs1'
ID637458
Institutional Source Beutler Lab
Gene Symbol Svs1
Ensembl Gene ENSMUSG00000039215
Gene Nameseminal vesicle secretory protein 1
SynonymsSVS I
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R8238 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location48986861-48991722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48990041 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 641 (E641G)
Ref Sequence ENSEMBL: ENSMUSP00000045221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037696]
Predicted Effect probably damaging
Transcript: ENSMUST00000037696
AA Change: E641G

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000045221
Gene: ENSMUSG00000039215
AA Change: E641G

DomainStartEndE-ValueType
Pfam:Cu_amine_oxidN2 44 130 1.5e-24 PFAM
Pfam:Cu_amine_oxidN3 146 246 2.7e-16 PFAM
internal_repeat_1 286 342 7.28e-22 PROSPERO
Pfam:Cu_amine_oxid 408 811 2e-92 PFAM
Meta Mutation Damage Score 0.4814 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 A G 8: 43,650,956 Y551H probably damaging Het
Ak1 T A 2: 32,633,669 V198D probably damaging Het
Alx1 C T 10: 103,022,215 D208N possibly damaging Het
Atp5b T A 10: 128,085,150 I182N possibly damaging Het
Cabp5 T A 7: 13,405,452 M134K probably damaging Het
Camsap2 A T 1: 136,294,026 I227N probably benign Het
Cfap44 G A 16: 44,415,305 probably null Het
Dpyd G A 3: 119,195,193 probably null Het
Etl4 C T 2: 20,806,531 R1510* probably null Het
Fgr C T 4: 132,997,521 A311V probably damaging Het
Glipr1 C T 10: 111,993,440 probably null Het
Gm10799 A G 2: 104,068,151 F70L probably benign Het
Gm14412 A T 2: 177,315,318 H261Q unknown Het
Hey2 T A 10: 30,840,663 M35L probably benign Het
Hspb7 A G 4: 141,422,546 Y81C probably damaging Het
Ipo5 A T 14: 120,935,240 K570M probably damaging Het
Iqsec1 A T 6: 90,689,930 H404Q probably benign Het
Kif5b T A 18: 6,227,619 Q86L probably damaging Het
Lrrtm4 T A 6: 80,022,685 I360N probably damaging Het
Mup6 T A 4: 60,003,634 V29E probably damaging Het
Ncstn G T 1: 172,072,476 A277E probably damaging Het
Nsun3 A G 16: 62,770,713 V189A probably damaging Het
Oaf C T 9: 43,239,345 D77N probably damaging Het
Olfr545 T C 7: 102,494,620 T52A possibly damaging Het
Olfr60 A C 7: 140,345,890 L33W probably damaging Het
Pard6a A G 8: 105,702,734 D138G probably damaging Het
Ppp4r4 A C 12: 103,590,807 H434P probably benign Het
Sec23b T C 2: 144,564,648 I121T probably benign Het
Slc36a3 C T 11: 55,131,607 V254I probably benign Het
Slc7a14 C A 3: 31,227,151 V337L probably benign Het
Tdh C T 14: 63,495,724 G206E probably damaging Het
Vmn1r231 T C 17: 20,890,378 T92A probably benign Het
Vmn2r36 T G 7: 7,889,016 H431P probably benign Het
Vmn2r92 G T 17: 18,185,016 M807I probably benign Het
Vps11 T C 9: 44,352,760 T759A probably benign Het
Xdh G T 17: 73,886,417 Q1295K probably benign Het
Other mutations in Svs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Svs1 APN 6 48987739 missense probably damaging 0.98
IGL01876:Svs1 APN 6 48990036 missense possibly damaging 0.71
IGL01934:Svs1 APN 6 48988761 missense probably damaging 0.97
IGL03002:Svs1 APN 6 48987118 missense probably benign 0.01
IGL03059:Svs1 APN 6 48987415 missense probably benign 0.13
IGL03213:Svs1 APN 6 48988345 missense possibly damaging 0.92
IGL03249:Svs1 APN 6 48988369 missense probably benign
IGL03365:Svs1 APN 6 48988597 missense probably damaging 0.97
PIT4280001:Svs1 UTSW 6 48987120 missense probably benign 0.01
PIT4495001:Svs1 UTSW 6 48987776 missense possibly damaging 0.92
R0010:Svs1 UTSW 6 48988906 missense probably damaging 0.99
R0528:Svs1 UTSW 6 48988031 missense probably benign
R0784:Svs1 UTSW 6 48987301 missense possibly damaging 0.78
R0959:Svs1 UTSW 6 48988632 missense possibly damaging 0.89
R1173:Svs1 UTSW 6 48990239 missense probably damaging 1.00
R1174:Svs1 UTSW 6 48990239 missense probably damaging 1.00
R1175:Svs1 UTSW 6 48990239 missense probably damaging 1.00
R1940:Svs1 UTSW 6 48990073 nonsense probably null
R3115:Svs1 UTSW 6 48987397 missense probably damaging 0.99
R3116:Svs1 UTSW 6 48987397 missense probably damaging 0.99
R3808:Svs1 UTSW 6 48987994 missense possibly damaging 0.93
R3809:Svs1 UTSW 6 48987994 missense possibly damaging 0.93
R3852:Svs1 UTSW 6 48987994 missense possibly damaging 0.93
R4455:Svs1 UTSW 6 48987460 missense possibly damaging 0.56
R4898:Svs1 UTSW 6 48987717 missense possibly damaging 0.95
R4933:Svs1 UTSW 6 48987492 missense probably damaging 1.00
R5108:Svs1 UTSW 6 48988570 missense probably damaging 0.97
R5320:Svs1 UTSW 6 48987575 missense probably benign 0.02
R6053:Svs1 UTSW 6 48988488 missense probably benign 0.42
R6728:Svs1 UTSW 6 48988845 missense possibly damaging 0.86
R6922:Svs1 UTSW 6 48987574 missense probably damaging 0.99
R7045:Svs1 UTSW 6 48988612 missense possibly damaging 0.81
R7046:Svs1 UTSW 6 48987578 missense probably benign 0.11
R7137:Svs1 UTSW 6 48990149 missense probably damaging 1.00
R7267:Svs1 UTSW 6 48988018 small deletion probably benign
R7874:Svs1 UTSW 6 48988666 missense possibly damaging 0.91
R7993:Svs1 UTSW 6 48987608 missense possibly damaging 0.85
X0022:Svs1 UTSW 6 48988339 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTAGCTCATCTGTAGGCCTC -3'
(R):5'- TAACACTTGCTCAGCCATGG -3'

Sequencing Primer
(F):5'- TTCCCACAGTGCTAACCGAGTG -3'
(R):5'- CTCAGCCATGGAGGGGACATG -3'
Posted On2020-07-13