Incidental Mutation 'R8238:Vmn1r231'
ID 637479
Institutional Source Beutler Lab
Gene Symbol Vmn1r231
Ensembl Gene ENSMUSG00000050933
Gene Name vomeronasal 1 receptor 231
Synonyms V1re7
MMRRC Submission 067670-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.052) question?
Stock # R8238 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 21109978-21110913 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 21110640 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 92 (T92A)
Ref Sequence ENSEMBL: ENSMUSP00000056228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061278]
AlphaFold Q8R2A3
Predicted Effect probably benign
Transcript: ENSMUST00000061278
AA Change: T92A

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000056228
Gene: ENSMUSG00000050933
AA Change: T92A

DomainStartEndE-ValueType
Pfam:TAS2R 6 294 1.6e-13 PFAM
Pfam:V1R 36 297 1.6e-27 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 A G 8: 44,103,993 (GRCm39) Y551H probably damaging Het
Ak1 T A 2: 32,523,681 (GRCm39) V198D probably damaging Het
Alx1 C T 10: 102,858,076 (GRCm39) D208N possibly damaging Het
Aoc1l3 A G 6: 48,966,975 (GRCm39) E641G probably damaging Het
Atp5f1b T A 10: 127,921,019 (GRCm39) I182N possibly damaging Het
Cabp5 T A 7: 13,139,377 (GRCm39) M134K probably damaging Het
Camsap2 A T 1: 136,221,764 (GRCm39) I227N probably benign Het
Cfap44 G A 16: 44,235,668 (GRCm39) probably null Het
Dpyd G A 3: 118,988,842 (GRCm39) probably null Het
Etl4 C T 2: 20,811,342 (GRCm39) R1510* probably null Het
Fgr C T 4: 132,724,832 (GRCm39) A311V probably damaging Het
Glipr1 C T 10: 111,829,345 (GRCm39) probably null Het
Gm10799 A G 2: 103,898,496 (GRCm39) F70L probably benign Het
Gm14412 A T 2: 177,007,111 (GRCm39) H261Q unknown Het
Hey2 T A 10: 30,716,659 (GRCm39) M35L probably benign Het
Hspb7 A G 4: 141,149,857 (GRCm39) Y81C probably damaging Het
Ipo5 A T 14: 121,172,652 (GRCm39) K570M probably damaging Het
Iqsec1 A T 6: 90,666,912 (GRCm39) H404Q probably benign Het
Kif5b T A 18: 6,227,619 (GRCm39) Q86L probably damaging Het
Lrrtm4 T A 6: 79,999,668 (GRCm39) I360N probably damaging Het
Mup6 T A 4: 60,003,634 (GRCm39) V29E probably damaging Het
Ncstn G T 1: 171,900,043 (GRCm39) A277E probably damaging Het
Nsun3 A G 16: 62,591,076 (GRCm39) V189A probably damaging Het
Oaf C T 9: 43,150,642 (GRCm39) D77N probably damaging Het
Or13a27 A C 7: 139,925,803 (GRCm39) L33W probably damaging Het
Or55b10 T C 7: 102,143,827 (GRCm39) T52A possibly damaging Het
Pard6a A G 8: 106,429,366 (GRCm39) D138G probably damaging Het
Ppp4r4 A C 12: 103,557,066 (GRCm39) H434P probably benign Het
Sec23b T C 2: 144,406,568 (GRCm39) I121T probably benign Het
Slc36a3 C T 11: 55,022,433 (GRCm39) V254I probably benign Het
Slc7a14 C A 3: 31,281,300 (GRCm39) V337L probably benign Het
Tdh C T 14: 63,733,173 (GRCm39) G206E probably damaging Het
Vmn2r36 T G 7: 7,892,015 (GRCm39) H431P probably benign Het
Vmn2r92 G T 17: 18,405,278 (GRCm39) M807I probably benign Het
Vps11 T C 9: 44,264,057 (GRCm39) T759A probably benign Het
Xdh G T 17: 74,193,412 (GRCm39) Q1295K probably benign Het
Other mutations in Vmn1r231
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Vmn1r231 APN 17 21,110,828 (GRCm39) missense possibly damaging 0.68
IGL02124:Vmn1r231 APN 17 21,110,568 (GRCm39) missense probably damaging 1.00
IGL02151:Vmn1r231 APN 17 21,109,997 (GRCm39) missense probably benign 0.06
R0066:Vmn1r231 UTSW 17 21,109,998 (GRCm39) missense probably benign 0.27
R0066:Vmn1r231 UTSW 17 21,109,998 (GRCm39) missense probably benign 0.27
R0396:Vmn1r231 UTSW 17 21,110,661 (GRCm39) missense probably damaging 0.98
R0427:Vmn1r231 UTSW 17 21,110,490 (GRCm39) missense probably benign 0.05
R0470:Vmn1r231 UTSW 17 21,110,265 (GRCm39) nonsense probably null
R0848:Vmn1r231 UTSW 17 21,110,433 (GRCm39) missense probably damaging 1.00
R1692:Vmn1r231 UTSW 17 21,110,871 (GRCm39) missense probably benign 0.02
R1987:Vmn1r231 UTSW 17 21,110,212 (GRCm39) missense probably damaging 1.00
R1988:Vmn1r231 UTSW 17 21,110,212 (GRCm39) missense probably damaging 1.00
R2105:Vmn1r231 UTSW 17 21,110,380 (GRCm39) missense possibly damaging 0.66
R4440:Vmn1r231 UTSW 17 21,110,718 (GRCm39) missense possibly damaging 0.48
R4634:Vmn1r231 UTSW 17 21,110,660 (GRCm39) missense possibly damaging 0.46
R4646:Vmn1r231 UTSW 17 21,110,571 (GRCm39) missense probably damaging 1.00
R4678:Vmn1r231 UTSW 17 21,110,489 (GRCm39) missense possibly damaging 0.94
R4696:Vmn1r231 UTSW 17 21,110,901 (GRCm39) missense possibly damaging 0.63
R4938:Vmn1r231 UTSW 17 21,110,613 (GRCm39) missense possibly damaging 0.76
R5544:Vmn1r231 UTSW 17 21,110,840 (GRCm39) missense probably damaging 1.00
R5942:Vmn1r231 UTSW 17 21,110,417 (GRCm39) missense possibly damaging 0.83
R6053:Vmn1r231 UTSW 17 21,110,081 (GRCm39) missense probably damaging 1.00
R6692:Vmn1r231 UTSW 17 21,110,745 (GRCm39) missense possibly damaging 0.46
R6712:Vmn1r231 UTSW 17 21,109,992 (GRCm39) missense possibly damaging 0.54
R7131:Vmn1r231 UTSW 17 21,110,140 (GRCm39) missense possibly damaging 0.87
R7854:Vmn1r231 UTSW 17 21,110,894 (GRCm39) missense probably damaging 0.98
R7918:Vmn1r231 UTSW 17 21,110,236 (GRCm39) nonsense probably null
R8187:Vmn1r231 UTSW 17 21,110,893 (GRCm39) missense probably benign 0.10
R8313:Vmn1r231 UTSW 17 21,110,289 (GRCm39) missense probably benign 0.02
R8525:Vmn1r231 UTSW 17 21,110,001 (GRCm39) missense probably benign 0.06
R9276:Vmn1r231 UTSW 17 21,110,560 (GRCm39) missense probably benign 0.00
RF010:Vmn1r231 UTSW 17 21,110,255 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCCTGTAAATTCATCATGACC -3'
(R):5'- CTTCAATGTTCAGTGGGAATTCTG -3'

Sequencing Primer
(F):5'- GCCTGTAAATTCATCATGACCTAAAC -3'
(R):5'- TCAGTGGGAATTCTGAAAAATATCTG -3'
Posted On 2020-07-13