Incidental Mutation 'R8239:Dennd1b'
ID637485
Institutional Source Beutler Lab
Gene Symbol Dennd1b
Ensembl Gene ENSMUSG00000056268
Gene NameDENN/MADD domain containing 1B
Synonyms4632404N19Rik, 6820401H01Rik, 4930467M19Rik, F730008N07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8239 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location138963435-139178960 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 139041935 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 63 (N63S)
Ref Sequence ENSEMBL: ENSMUSP00000142738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094505] [ENSMUST00000168527] [ENSMUST00000198759] [ENSMUST00000200429] [ENSMUST00000200533]
Predicted Effect probably benign
Transcript: ENSMUST00000094505
SMART Domains Protein: ENSMUSP00000092082
Gene: ENSMUSG00000056268

DomainStartEndE-ValueType
DENN 15 196 1.14e-74 SMART
dDENN 227 293 1.07e-20 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000127580
Gene: ENSMUSG00000056268
AA Change: N63S

DomainStartEndE-ValueType
uDENN 9 89 7.86e-28 SMART
DENN 90 271 1.14e-74 SMART
dDENN 302 368 1.07e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198759
Predicted Effect probably benign
Transcript: ENSMUST00000200429
AA Change: N63S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000143783
Gene: ENSMUSG00000056268
AA Change: N63S

DomainStartEndE-ValueType
uDENN 9 89 3.2e-31 SMART
DENN 90 271 4.8e-78 SMART
low complexity region 307 318 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200533
AA Change: N63S

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000142738
Gene: ENSMUSG00000056268
AA Change: N63S

DomainStartEndE-ValueType
uDENN 9 89 7.86e-28 SMART
DENN 90 232 4.61e-6 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Clathrin (see MIM 118955)-mediated endocytosis is a major mechanism for internalization of proteins and lipids. Members of the connecdenn family, such as DENND1B, function as guanine nucleotide exchange factors (GEFs) for the early endosomal small GTPase RAB35 (MIM 604199) and bind to clathrin and clathrin adaptor protein-2 (AP2; see MIM 601024). Thus, connecdenns link RAB35 activation with the clathrin machinery (Marat and McPherson, 2010 [PubMed 20154091]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous KO results in enhanced allergic responses to aerosolized antigen challenges caused by delayed TCR down-modulation following receptor activation in T helper 2 cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T C 8: 40,825,069 S166P probably damaging Het
Appl1 T A 14: 26,964,957 T19S probably damaging Het
Arid4b T A 13: 14,170,009 D557E probably benign Het
Aven C T 2: 112,559,775 R8W probably benign Het
C2cd2l T C 9: 44,316,205 E307G possibly damaging Het
Cdh7 A C 1: 110,100,102 T526P probably benign Het
Dchs1 C T 7: 105,765,511 V775M probably benign Het
Dtnb A T 12: 3,644,056 Y248F unknown Het
Ehbp1l1 T A 19: 5,720,061 T405S possibly damaging Het
Fam149a A G 8: 45,350,453 Y415H possibly damaging Het
Fam186a A G 15: 99,941,310 L2351P unknown Het
Fsip2 T G 2: 82,989,343 I5140S possibly damaging Het
Gm8674 T C 13: 49,900,226 T749A noncoding transcript Het
Grasp C T 15: 101,231,021 L217F probably damaging Het
Inadl A G 4: 98,682,071 E1711G possibly damaging Het
Kalrn A G 16: 34,049,783 V1894A noncoding transcript Het
Kpna3 A T 14: 61,387,470 N141K probably damaging Het
Lrba G A 3: 86,542,575 G2067D probably damaging Het
Lrp2 G T 2: 69,481,267 Y2622* probably null Het
Lrtm2 A C 6: 119,320,817 F88V probably damaging Het
Mboat1 T C 13: 30,245,350 S454P probably damaging Het
Nkpd1 C T 7: 19,519,828 P40S probably benign Het
Olfr1065 C A 2: 86,445,129 M284I noncoding transcript Het
Olfr1249 T A 2: 89,630,563 I112F probably damaging Het
Olfr1535 T C 13: 21,555,618 I135V probably benign Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pcdha4 A T 18: 36,953,075 I104F probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Plekhg4 C T 8: 105,380,914 R990* probably null Het
Pphln1 T C 15: 93,489,049 S343P probably benign Het
Pram1 A T 17: 33,641,267 K269N probably damaging Het
Psmd13 T A 7: 140,886,537 I79K probably damaging Het
Ptprf T C 4: 118,212,112 D1586G possibly damaging Het
Ptprh T A 7: 4,581,091 Q167H probably damaging Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Rreb1 T C 13: 37,893,872 M20T probably damaging Het
Scrn2 T G 11: 97,032,220 L163R probably damaging Het
Slc36a3 C T 11: 55,131,607 V254I probably benign Het
Slc6a6 T C 6: 91,724,970 F120L probably benign Het
Slc8a2 A T 7: 16,145,305 H572L probably benign Het
Spats2 T A 15: 99,208,895 D357E probably damaging Het
Speg A T 1: 75,419,033 N1816I probably damaging Het
Sult2b1 A G 7: 45,783,937 V2A unknown Het
Susd3 T C 13: 49,231,255 T231A probably benign Het
Tcp1 A G 17: 12,920,851 D261G probably benign Het
Trpm2 C G 10: 77,936,002 S601T probably benign Het
Ugt2b38 A T 5: 87,423,800 F124L probably benign Het
Unc80 G T 1: 66,654,019 E2522D probably benign Het
Usp34 A G 11: 23,446,750 T2365A Het
Vmn2r92 G T 17: 18,185,016 M807I probably benign Het
Vps13b C A 15: 35,597,404 P1030Q probably damaging Het
Wrn T G 8: 33,329,185 K246N probably damaging Het
Zer1 T A 2: 30,101,135 probably null Het
Other mutations in Dennd1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Dennd1b APN 1 139062940 missense probably damaging 1.00
IGL00510:Dennd1b APN 1 139102071 missense probably damaging 1.00
IGL00671:Dennd1b APN 1 139133737 missense possibly damaging 0.94
IGL00937:Dennd1b APN 1 139170239 missense probably benign 0.01
IGL00959:Dennd1b APN 1 139143888 splice site probably benign
IGL01446:Dennd1b APN 1 139023110 missense possibly damaging 0.61
IGL01610:Dennd1b APN 1 139169766 utr 3 prime probably benign
IGL02275:Dennd1b APN 1 139081254 missense probably damaging 1.00
IGL02851:Dennd1b APN 1 139168967 utr 3 prime probably benign
IGL02995:Dennd1b APN 1 139081242 missense probably damaging 1.00
IGL03089:Dennd1b APN 1 139102029 missense possibly damaging 0.94
IGL03240:Dennd1b APN 1 139139392 missense possibly damaging 0.63
IGL03267:Dennd1b APN 1 139062861 nonsense probably null
Dendrite UTSW 1 139053417 critical splice donor site probably null
LCD18:Dennd1b UTSW 1 139114764 intron probably benign
PIT4418001:Dennd1b UTSW 1 139081261 missense
PIT4504001:Dennd1b UTSW 1 139040004 missense probably benign 0.28
R0426:Dennd1b UTSW 1 139170196 missense probably benign
R0445:Dennd1b UTSW 1 139167765 splice site probably benign
R0497:Dennd1b UTSW 1 139039986 splice site probably benign
R0627:Dennd1b UTSW 1 139081219 missense probably damaging 1.00
R1027:Dennd1b UTSW 1 139041962 missense probably damaging 1.00
R1599:Dennd1b UTSW 1 139167730 missense probably benign 0.01
R1703:Dennd1b UTSW 1 139169754 critical splice acceptor site probably null
R1844:Dennd1b UTSW 1 139090405 splice site probably null
R1943:Dennd1b UTSW 1 139168952 utr 3 prime probably benign
R2504:Dennd1b UTSW 1 139170170 utr 3 prime probably benign
R2866:Dennd1b UTSW 1 139170281 missense possibly damaging 0.58
R3109:Dennd1b UTSW 1 139041916 splice site probably benign
R3843:Dennd1b UTSW 1 139053354 missense probably damaging 1.00
R3926:Dennd1b UTSW 1 139143959 missense probably benign 0.00
R4258:Dennd1b UTSW 1 139062940 missense probably damaging 1.00
R4504:Dennd1b UTSW 1 139085927 missense possibly damaging 0.82
R4805:Dennd1b UTSW 1 139053384 missense probably damaging 1.00
R4922:Dennd1b UTSW 1 139085914 missense probably damaging 0.99
R4954:Dennd1b UTSW 1 139053386 missense probably damaging 1.00
R5098:Dennd1b UTSW 1 139133721 missense probably damaging 0.97
R5205:Dennd1b UTSW 1 139054568 missense probably benign 0.00
R5240:Dennd1b UTSW 1 139062877 missense probably damaging 1.00
R5383:Dennd1b UTSW 1 139167671 missense probably benign
R5504:Dennd1b UTSW 1 139090508 missense probably benign 0.07
R5702:Dennd1b UTSW 1 139133675 missense probably damaging 1.00
R5801:Dennd1b UTSW 1 139039989 splice site probably null
R6144:Dennd1b UTSW 1 139081255 missense probably damaging 1.00
R6190:Dennd1b UTSW 1 139133675 missense probably damaging 1.00
R6192:Dennd1b UTSW 1 139167718 missense probably benign 0.00
R6289:Dennd1b UTSW 1 139168945 utr 3 prime probably benign
R6453:Dennd1b UTSW 1 139143948 missense probably benign 0.07
R6479:Dennd1b UTSW 1 139041960 intron probably benign
R6940:Dennd1b UTSW 1 139053417 critical splice donor site probably null
R6954:Dennd1b UTSW 1 139168945 utr 3 prime probably benign
R7183:Dennd1b UTSW 1 139170252 missense unknown
R7710:Dennd1b UTSW 1 139062932 missense probably damaging 1.00
R7742:Dennd1b UTSW 1 139062873 missense probably damaging 1.00
R7796:Dennd1b UTSW 1 139062873 missense probably damaging 1.00
R7871:Dennd1b UTSW 1 139062873 missense probably damaging 1.00
R7920:Dennd1b UTSW 1 139062873 missense probably damaging 1.00
R7921:Dennd1b UTSW 1 139062873 missense probably damaging 1.00
R7991:Dennd1b UTSW 1 139085896 missense
R8025:Dennd1b UTSW 1 139110420 missense
RF008:Dennd1b UTSW 1 139053397 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGCTGTGCTCTCCCATAAG -3'
(R):5'- CATGATATAGCTGGACAAAGACAC -3'

Sequencing Primer
(F):5'- GTGCTCTCCCATAAGCTGTTAGAAG -3'
(R):5'- GCTGGACAAAGACACAATCTATTTTG -3'
Posted On2020-07-13