Incidental Mutation 'R8239:Rbm46'
ID637492
Institutional Source Beutler Lab
Gene Symbol Rbm46
Ensembl Gene ENSMUSG00000033882
Gene NameRNA binding motif protein 46
SynonymsENSMUSG00000033882, LOC329687
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.338) question?
Stock #R8239 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location82837228-82876483 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 82865468 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 119 (R119Q)
Ref Sequence ENSEMBL: ENSMUSP00000045511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048647] [ENSMUST00000182637] [ENSMUST00000182818]
Predicted Effect probably benign
Transcript: ENSMUST00000048647
AA Change: R119Q

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000045511
Gene: ENSMUSG00000033882
AA Change: R119Q

DomainStartEndE-ValueType
low complexity region 46 60 N/A INTRINSIC
RRM 62 135 8.13e-15 SMART
RRM 142 219 1.36e-7 SMART
RRM 237 304 4.23e-13 SMART
Pfam:DND1_DSRM 392 468 9.4e-30 PFAM
low complexity region 494 514 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182637
AA Change: R119Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000138728
Gene: ENSMUSG00000033882
AA Change: R119Q

DomainStartEndE-ValueType
low complexity region 46 60 N/A INTRINSIC
RRM 62 135 8.13e-15 SMART
RRM 142 219 1.36e-7 SMART
RRM 237 304 4.23e-13 SMART
Pfam:DND1_DSRM 392 468 1.3e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182818
AA Change: R119Q

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000138429
Gene: ENSMUSG00000033882
AA Change: R119Q

DomainStartEndE-ValueType
low complexity region 46 60 N/A INTRINSIC
RRM 62 135 8.13e-15 SMART
RRM 142 219 1.36e-7 SMART
RRM 237 304 4.23e-13 SMART
Pfam:DND1_DSRM 392 468 2.1e-29 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T C 8: 40,825,069 S166P probably damaging Het
Appl1 T A 14: 26,964,957 T19S probably damaging Het
Arid4b T A 13: 14,170,009 D557E probably benign Het
Aven C T 2: 112,559,775 R8W probably benign Het
C2cd2l T C 9: 44,316,205 E307G possibly damaging Het
Cdh7 A C 1: 110,100,102 T526P probably benign Het
Dchs1 C T 7: 105,765,511 V775M probably benign Het
Dennd1b A G 1: 139,041,935 N63S probably benign Het
Dtnb A T 12: 3,644,056 Y248F unknown Het
Ehbp1l1 T A 19: 5,720,061 T405S possibly damaging Het
Fam149a A G 8: 45,350,453 Y415H possibly damaging Het
Fam186a A G 15: 99,941,310 L2351P unknown Het
Fsip2 T G 2: 82,989,343 I5140S possibly damaging Het
Gm8674 T C 13: 49,900,226 T749A noncoding transcript Het
Grasp C T 15: 101,231,021 L217F probably damaging Het
Inadl A G 4: 98,682,071 E1711G possibly damaging Het
Kalrn A G 16: 34,049,783 V1894A noncoding transcript Het
Kpna3 A T 14: 61,387,470 N141K probably damaging Het
Lrba G A 3: 86,542,575 G2067D probably damaging Het
Lrp2 G T 2: 69,481,267 Y2622* probably null Het
Lrtm2 A C 6: 119,320,817 F88V probably damaging Het
Mboat1 T C 13: 30,245,350 S454P probably damaging Het
Nkpd1 C T 7: 19,519,828 P40S probably benign Het
Olfr1065 C A 2: 86,445,129 M284I noncoding transcript Het
Olfr1249 T A 2: 89,630,563 I112F probably damaging Het
Olfr1535 T C 13: 21,555,618 I135V probably benign Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pcdha4 A T 18: 36,953,075 I104F probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Plekhg4 C T 8: 105,380,914 R990* probably null Het
Pphln1 T C 15: 93,489,049 S343P probably benign Het
Pram1 A T 17: 33,641,267 K269N probably damaging Het
Psmd13 T A 7: 140,886,537 I79K probably damaging Het
Ptprf T C 4: 118,212,112 D1586G possibly damaging Het
Ptprh T A 7: 4,581,091 Q167H probably damaging Het
Rreb1 T C 13: 37,893,872 M20T probably damaging Het
Scrn2 T G 11: 97,032,220 L163R probably damaging Het
Slc36a3 C T 11: 55,131,607 V254I probably benign Het
Slc6a6 T C 6: 91,724,970 F120L probably benign Het
Slc8a2 A T 7: 16,145,305 H572L probably benign Het
Spats2 T A 15: 99,208,895 D357E probably damaging Het
Speg A T 1: 75,419,033 N1816I probably damaging Het
Sult2b1 A G 7: 45,783,937 V2A unknown Het
Susd3 T C 13: 49,231,255 T231A probably benign Het
Tcp1 A G 17: 12,920,851 D261G probably benign Het
Trpm2 C G 10: 77,936,002 S601T probably benign Het
Ugt2b38 A T 5: 87,423,800 F124L probably benign Het
Unc80 G T 1: 66,654,019 E2522D probably benign Het
Usp34 A G 11: 23,446,750 T2365A Het
Vmn2r92 G T 17: 18,185,016 M807I probably benign Het
Vps13b C A 15: 35,597,404 P1030Q probably damaging Het
Wrn T G 8: 33,329,185 K246N probably damaging Het
Zer1 T A 2: 30,101,135 probably null Het
Other mutations in Rbm46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02261:Rbm46 APN 3 82864416 missense possibly damaging 0.85
R0048:Rbm46 UTSW 3 82864230 missense probably damaging 0.96
R0554:Rbm46 UTSW 3 82865268 missense probably damaging 1.00
R1606:Rbm46 UTSW 3 82864541 missense probably damaging 1.00
R2200:Rbm46 UTSW 3 82864044 missense probably benign 0.00
R2357:Rbm46 UTSW 3 82864458 missense probably benign 0.00
R4646:Rbm46 UTSW 3 82864458 missense probably benign 0.00
R4647:Rbm46 UTSW 3 82864458 missense probably benign 0.00
R4648:Rbm46 UTSW 3 82864458 missense probably benign 0.00
R5584:Rbm46 UTSW 3 82864158 missense probably benign
R5722:Rbm46 UTSW 3 82865333 missense possibly damaging 0.95
R6393:Rbm46 UTSW 3 82863955 missense probably benign 0.03
R7228:Rbm46 UTSW 3 82842533 missense probably benign
R7438:Rbm46 UTSW 3 82842488 nonsense probably null
R7445:Rbm46 UTSW 3 82864210 missense probably damaging 0.99
R7452:Rbm46 UTSW 3 82864121 missense probably benign 0.01
R8195:Rbm46 UTSW 3 82865468 missense probably benign 0.01
R8196:Rbm46 UTSW 3 82865468 missense probably benign 0.01
R8211:Rbm46 UTSW 3 82865468 missense probably benign 0.01
R8212:Rbm46 UTSW 3 82865468 missense probably benign 0.01
R8235:Rbm46 UTSW 3 82865468 missense probably benign 0.01
R8276:Rbm46 UTSW 3 82864588 missense probably damaging 0.99
Z1177:Rbm46 UTSW 3 82837318 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAACCCACGGTTCTTGGTTTTG -3'
(R):5'- TTCAGGTTGGGAAGGTCCAC -3'

Sequencing Primer
(F):5'- TGTCAGTTGCACTTGGATAAAC -3'
(R):5'- TCCCCCTAGAGGTTGTGAAG -3'
Posted On2020-07-13