Incidental Mutation 'R8239:Inadl'
ID637494
Institutional Source Beutler Lab
Gene Symbol Inadl
Ensembl Gene ENSMUSG00000061859
Gene Name
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8239 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98682071 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1711 (E1711G)
Ref Sequence ENSEMBL: ENSMUSP00000049176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030290] [ENSMUST00000041284] [ENSMUST00000102792] [ENSMUST00000107029]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030290
AA Change: E489G

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030290
Gene: ENSMUSG00000061859
AA Change: E489G

DomainStartEndE-ValueType
PDZ 31 106 6.12e-19 SMART
low complexity region 134 144 N/A INTRINSIC
low complexity region 188 206 N/A INTRINSIC
PDZ 258 333 4.36e-24 SMART
PDZ 355 428 2.49e-19 SMART
PDZ 496 573 1.73e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000041284
AA Change: E1711G

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049176
Gene: ENSMUSG00000061859
AA Change: E1711G

DomainStartEndE-ValueType
L27 8 68 6.53e-9 SMART
PDZ 143 221 1.78e-20 SMART
PDZ 256 328 1.15e-23 SMART
PDZ 374 453 3.15e-21 SMART
coiled coil region 486 513 N/A INTRINSIC
PDZ 570 641 1.28e-12 SMART
PDZ 696 775 9.5e-16 SMART
low complexity region 980 991 N/A INTRINSIC
low complexity region 1054 1062 N/A INTRINSIC
PDZ 1083 1166 8.65e-19 SMART
PDZ 1253 1328 6.12e-19 SMART
low complexity region 1356 1366 N/A INTRINSIC
low complexity region 1410 1428 N/A INTRINSIC
PDZ 1480 1555 4.36e-24 SMART
PDZ 1577 1650 2.49e-19 SMART
PDZ 1718 1795 2.13e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102792
AA Change: E489G

PolyPhen 2 Score 0.621 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099854
Gene: ENSMUSG00000061859
AA Change: E489G

DomainStartEndE-ValueType
PDZ 31 106 6.12e-19 SMART
low complexity region 134 144 N/A INTRINSIC
low complexity region 188 206 N/A INTRINSIC
PDZ 258 333 4.36e-24 SMART
PDZ 355 428 2.49e-19 SMART
PDZ 496 573 2.13e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107029
AA Change: E1138G

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102644
Gene: ENSMUSG00000061859
AA Change: E1138G

DomainStartEndE-ValueType
PDZ 1 68 1e-9 SMART
PDZ 123 202 4.7e-18 SMART
low complexity region 407 418 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
PDZ 510 593 4.3e-21 SMART
PDZ 680 755 2.9e-21 SMART
low complexity region 783 793 N/A INTRINSIC
low complexity region 837 855 N/A INTRINSIC
PDZ 907 982 2.2e-26 SMART
PDZ 1004 1077 1.2e-21 SMART
PDZ 1145 1222 1e-20 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T C 8: 40,825,069 S166P probably damaging Het
Appl1 T A 14: 26,964,957 T19S probably damaging Het
Arid4b T A 13: 14,170,009 D557E probably benign Het
Aven C T 2: 112,559,775 R8W probably benign Het
C2cd2l T C 9: 44,316,205 E307G possibly damaging Het
Cdh7 A C 1: 110,100,102 T526P probably benign Het
Dchs1 C T 7: 105,765,511 V775M probably benign Het
Dennd1b A G 1: 139,041,935 N63S probably benign Het
Dtnb A T 12: 3,644,056 Y248F unknown Het
Ehbp1l1 T A 19: 5,720,061 T405S possibly damaging Het
Fam149a A G 8: 45,350,453 Y415H possibly damaging Het
Fam186a A G 15: 99,941,310 L2351P unknown Het
Fsip2 T G 2: 82,989,343 I5140S possibly damaging Het
Gm8674 T C 13: 49,900,226 T749A noncoding transcript Het
Grasp C T 15: 101,231,021 L217F probably damaging Het
Kalrn A G 16: 34,049,783 V1894A noncoding transcript Het
Kpna3 A T 14: 61,387,470 N141K probably damaging Het
Lrba G A 3: 86,542,575 G2067D probably damaging Het
Lrp2 G T 2: 69,481,267 Y2622* probably null Het
Lrtm2 A C 6: 119,320,817 F88V probably damaging Het
Mboat1 T C 13: 30,245,350 S454P probably damaging Het
Nkpd1 C T 7: 19,519,828 P40S probably benign Het
Olfr1065 C A 2: 86,445,129 M284I noncoding transcript Het
Olfr1249 T A 2: 89,630,563 I112F probably damaging Het
Olfr1535 T C 13: 21,555,618 I135V probably benign Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pcdha4 A T 18: 36,953,075 I104F probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Plekhg4 C T 8: 105,380,914 R990* probably null Het
Pphln1 T C 15: 93,489,049 S343P probably benign Het
Pram1 A T 17: 33,641,267 K269N probably damaging Het
Psmd13 T A 7: 140,886,537 I79K probably damaging Het
Ptprf T C 4: 118,212,112 D1586G possibly damaging Het
Ptprh T A 7: 4,581,091 Q167H probably damaging Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Rreb1 T C 13: 37,893,872 M20T probably damaging Het
Scrn2 T G 11: 97,032,220 L163R probably damaging Het
Slc36a3 C T 11: 55,131,607 V254I probably benign Het
Slc6a6 T C 6: 91,724,970 F120L probably benign Het
Slc8a2 A T 7: 16,145,305 H572L probably benign Het
Spats2 T A 15: 99,208,895 D357E probably damaging Het
Speg A T 1: 75,419,033 N1816I probably damaging Het
Sult2b1 A G 7: 45,783,937 V2A unknown Het
Susd3 T C 13: 49,231,255 T231A probably benign Het
Tcp1 A G 17: 12,920,851 D261G probably benign Het
Trpm2 C G 10: 77,936,002 S601T probably benign Het
Ugt2b38 A T 5: 87,423,800 F124L probably benign Het
Unc80 G T 1: 66,654,019 E2522D probably benign Het
Usp34 A G 11: 23,446,750 T2365A Het
Vmn2r92 G T 17: 18,185,016 M807I probably benign Het
Vps13b C A 15: 35,597,404 P1030Q probably damaging Het
Wrn T G 8: 33,329,185 K246N probably damaging Het
Zer1 T A 2: 30,101,135 probably null Het
Other mutations in Inadl
AlleleSourceChrCoordTypePredicted EffectPPH Score
R8183:Inadl UTSW 4 98674229 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCCCTGAAGACTCAGTTCAGTC -3'
(R):5'- AATGTCCAGCATTCTGTTGTG -3'

Sequencing Primer
(F):5'- GAAGACTCAGTTCAGTCCTGGTAC -3'
(R):5'- ACACACACACTATTATGAAAAGGAG -3'
Posted On2020-07-13