Incidental Mutation 'R8239:Peg10'
ID637497
Institutional Source Beutler Lab
Gene Symbol Peg10
Ensembl Gene ENSMUSG00000092035
Gene Namepaternally expressed 10
SynonymsHB-1, MyEF-3, Mart2, Mar2, MyEF-3 like, MEF3L, Edr
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8239 (G1)
Quality Score217.468
Status Not validated
Chromosome6
Chromosomal Location4747306-4760517 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) GC to GCTCC at 4756452 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166678] [ENSMUST00000176204] [ENSMUST00000176551]
Predicted Effect probably benign
Transcript: ENSMUST00000166678
SMART Domains Protein: ENSMUSP00000127306
Gene: ENSMUSG00000092035

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 34 50 N/A INTRINSIC
low complexity region 80 107 N/A INTRINSIC
Pfam:DUF4939 130 220 6.1e-17 PFAM
Pfam:Retrotrans_gag 174 267 2.9e-20 PFAM
low complexity region 334 342 N/A INTRINSIC
ZnF_C2HC 345 361 3.34e-2 SMART
low complexity region 368 379 N/A INTRINSIC
low complexity region 541 610 N/A INTRINSIC
low complexity region 621 660 N/A INTRINSIC
low complexity region 663 785 N/A INTRINSIC
Blast:SERPIN 798 910 1e-5 BLAST
low complexity region 923 936 N/A INTRINSIC
low complexity region 972 998 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176204
SMART Domains Protein: ENSMUSP00000134963
Gene: ENSMUSG00000092035

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 34 50 N/A INTRINSIC
low complexity region 80 107 N/A INTRINSIC
Pfam:Retrotrans_gag 174 267 1.3e-20 PFAM
low complexity region 334 342 N/A INTRINSIC
ZnF_C2HC 345 361 3.34e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176551
SMART Domains Protein: ENSMUSP00000135076
Gene: ENSMUSG00000092035

DomainStartEndE-ValueType
low complexity region 173 242 N/A INTRINSIC
low complexity region 253 292 N/A INTRINSIC
low complexity region 295 417 N/A INTRINSIC
Blast:SERPIN 430 542 6e-6 BLAST
low complexity region 555 568 N/A INTRINSIC
low complexity region 604 630 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This is a paternally expressed imprinted gene that is thought to have been derived from the Ty3/Gypsy family of retrotransposons. It contains two overlapping open reading frames, RF1 and RF2, and expresses two proteins: a shorter, gag-like protein (with a CCHC-type zinc finger domain) from RF1; and a longer, gag/pol-like fusion protein (with an additional aspartic protease motif) from RF1/RF2 by -1 translational frameshifting (-1 FS). While -1 FS has been observed in RNA viruses and transposons in both prokaryotes and eukaryotes, this gene represents the first example of -1 FS in a eukaryotic cellular gene. This gene is highly conserved across mammalian species and retains the heptanucleotide (GGGAAAC) and pseudoknot elements required for -1 FS. It is expressed in adult and embryonic tissues (most notably in placenta) and reported to have a role in cell proliferation, differentiation, apoptosis and cancer development. Knockout mice lacking this gene showed early embryonic lethality with placental defects, indicating the importance of this gene in embryonic development. [provided by RefSeq, Oct 2014]
PHENOTYPE: Heterozygous mice with a paternally inherited null allele display embryonic lethality during organogenesis with abnormal placental development. Heterozygous mice with a maternally inherited null allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T C 8: 40,825,069 S166P probably damaging Het
Appl1 T A 14: 26,964,957 T19S probably damaging Het
Arid4b T A 13: 14,170,009 D557E probably benign Het
Aven C T 2: 112,559,775 R8W probably benign Het
C2cd2l T C 9: 44,316,205 E307G possibly damaging Het
Cdh7 A C 1: 110,100,102 T526P probably benign Het
Dchs1 C T 7: 105,765,511 V775M probably benign Het
Dennd1b A G 1: 139,041,935 N63S probably benign Het
Dtnb A T 12: 3,644,056 Y248F unknown Het
Ehbp1l1 T A 19: 5,720,061 T405S possibly damaging Het
Fam149a A G 8: 45,350,453 Y415H possibly damaging Het
Fam186a A G 15: 99,941,310 L2351P unknown Het
Fsip2 T G 2: 82,989,343 I5140S possibly damaging Het
Gm8674 T C 13: 49,900,226 T749A noncoding transcript Het
Grasp C T 15: 101,231,021 L217F probably damaging Het
Inadl A G 4: 98,682,071 E1711G possibly damaging Het
Kalrn A G 16: 34,049,783 V1894A noncoding transcript Het
Kpna3 A T 14: 61,387,470 N141K probably damaging Het
Lrba G A 3: 86,542,575 G2067D probably damaging Het
Lrp2 G T 2: 69,481,267 Y2622* probably null Het
Lrtm2 A C 6: 119,320,817 F88V probably damaging Het
Mboat1 T C 13: 30,245,350 S454P probably damaging Het
Nkpd1 C T 7: 19,519,828 P40S probably benign Het
Olfr1065 C A 2: 86,445,129 M284I noncoding transcript Het
Olfr1249 T A 2: 89,630,563 I112F probably damaging Het
Olfr1535 T C 13: 21,555,618 I135V probably benign Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pcdha4 A T 18: 36,953,075 I104F probably damaging Het
Plekhg4 C T 8: 105,380,914 R990* probably null Het
Pphln1 T C 15: 93,489,049 S343P probably benign Het
Pram1 A T 17: 33,641,267 K269N probably damaging Het
Psmd13 T A 7: 140,886,537 I79K probably damaging Het
Ptprf T C 4: 118,212,112 D1586G possibly damaging Het
Ptprh T A 7: 4,581,091 Q167H probably damaging Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Rreb1 T C 13: 37,893,872 M20T probably damaging Het
Scrn2 T G 11: 97,032,220 L163R probably damaging Het
Slc36a3 C T 11: 55,131,607 V254I probably benign Het
Slc6a6 T C 6: 91,724,970 F120L probably benign Het
Slc8a2 A T 7: 16,145,305 H572L probably benign Het
Spats2 T A 15: 99,208,895 D357E probably damaging Het
Speg A T 1: 75,419,033 N1816I probably damaging Het
Sult2b1 A G 7: 45,783,937 V2A unknown Het
Susd3 T C 13: 49,231,255 T231A probably benign Het
Tcp1 A G 17: 12,920,851 D261G probably benign Het
Trpm2 C G 10: 77,936,002 S601T probably benign Het
Ugt2b38 A T 5: 87,423,800 F124L probably benign Het
Unc80 G T 1: 66,654,019 E2522D probably benign Het
Usp34 A G 11: 23,446,750 T2365A Het
Vmn2r92 G T 17: 18,185,016 M807I probably benign Het
Vps13b C A 15: 35,597,404 P1030Q probably damaging Het
Wrn T G 8: 33,329,185 K246N probably damaging Het
Zer1 T A 2: 30,101,135 probably null Het
Other mutations in Peg10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02029:Peg10 APN 6 4754473 utr 5 prime probably benign
IGL03063:Peg10 APN 6 4756647 utr 3 prime probably benign
piaggio UTSW 6 4756427 utr 3 prime probably benign
PIT4480001:Peg10 UTSW 6 4756560 missense unknown
R0090:Peg10 UTSW 6 4756063 utr 3 prime probably benign
R0148:Peg10 UTSW 6 4755711 missense possibly damaging 0.88
R0650:Peg10 UTSW 6 4756475 small insertion probably benign
R0698:Peg10 UTSW 6 4756835 utr 3 prime probably benign
R1600:Peg10 UTSW 6 4757080 utr 3 prime probably benign
R1842:Peg10 UTSW 6 4756381 utr 3 prime probably benign
R1930:Peg10 UTSW 6 4755778 missense probably damaging 0.99
R1931:Peg10 UTSW 6 4755778 missense probably damaging 0.99
R2162:Peg10 UTSW 6 4755914 utr 3 prime probably benign
R2215:Peg10 UTSW 6 4756918 utr 3 prime probably benign
R2339:Peg10 UTSW 6 4756102 utr 3 prime probably benign
R2847:Peg10 UTSW 6 4756912 utr 3 prime probably benign
R2848:Peg10 UTSW 6 4756912 utr 3 prime probably benign
R3000:Peg10 UTSW 6 4754276 utr 5 prime probably benign
R3056:Peg10 UTSW 6 4755029 missense possibly damaging 0.66
R4051:Peg10 UTSW 6 4754534 missense probably benign 0.00
R4059:Peg10 UTSW 6 4756427 utr 3 prime probably benign
R4296:Peg10 UTSW 6 4756472 small insertion probably benign
R4626:Peg10 UTSW 6 4756460 small insertion probably benign
R4634:Peg10 UTSW 6 4756452 small insertion probably benign
R4679:Peg10 UTSW 6 4756452 small insertion probably benign
R4834:Peg10 UTSW 6 4754294 utr 5 prime probably benign
R4982:Peg10 UTSW 6 4756451 small insertion probably benign
R4983:Peg10 UTSW 6 4756451 small insertion probably benign
R4996:Peg10 UTSW 6 4756454 small insertion probably benign
R4997:Peg10 UTSW 6 4756457 small insertion probably benign
R5015:Peg10 UTSW 6 4756453 small insertion probably benign
R5085:Peg10 UTSW 6 4755864 utr 3 prime probably benign
R5091:Peg10 UTSW 6 4754511 missense probably benign 0.01
R5231:Peg10 UTSW 6 4756939 utr 3 prime probably benign
R5278:Peg10 UTSW 6 4756442 small deletion probably benign
R5364:Peg10 UTSW 6 4756128 utr 3 prime probably benign
R5397:Peg10 UTSW 6 4756453 small insertion probably benign
R5485:Peg10 UTSW 6 4755565 missense probably benign 0.09
R5573:Peg10 UTSW 6 4755913 utr 3 prime probably benign
R5710:Peg10 UTSW 6 4756350 small insertion probably benign
R5710:Peg10 UTSW 6 4756351 small insertion probably benign
R5736:Peg10 UTSW 6 4754423 missense probably benign 0.00
R5865:Peg10 UTSW 6 4754375 missense probably damaging 0.98
R6056:Peg10 UTSW 6 4756449 small insertion probably benign
R6116:Peg10 UTSW 6 4756351 small insertion probably benign
R6129:Peg10 UTSW 6 4756449 small insertion probably benign
R6147:Peg10 UTSW 6 4754499 start gained probably benign
R6171:Peg10 UTSW 6 4756449 small insertion probably benign
R6194:Peg10 UTSW 6 4756351 small insertion probably benign
R6197:Peg10 UTSW 6 4756452 small insertion probably benign
R6207:Peg10 UTSW 6 4756449 small insertion probably benign
R6215:Peg10 UTSW 6 4756452 small insertion probably benign
R6276:Peg10 UTSW 6 4756449 small insertion probably benign
R6281:Peg10 UTSW 6 4756449 small insertion probably benign
R6287:Peg10 UTSW 6 4756451 small insertion probably benign
R6302:Peg10 UTSW 6 4756449 small insertion probably benign
R6393:Peg10 UTSW 6 4756452 small insertion probably benign
R6394:Peg10 UTSW 6 4756451 small insertion probably benign
R6405:Peg10 UTSW 6 4756453 small insertion probably benign
R6421:Peg10 UTSW 6 4756449 small insertion probably benign
R6486:Peg10 UTSW 6 4756449 small insertion probably benign
R6538:Peg10 UTSW 6 4756449 small insertion probably benign
R6668:Peg10 UTSW 6 4754502 missense probably benign 0.01
R6679:Peg10 UTSW 6 4754276 utr 5 prime probably benign
R6685:Peg10 UTSW 6 4754738 missense probably damaging 1.00
R6702:Peg10 UTSW 6 4756452 small insertion probably benign
R6706:Peg10 UTSW 6 4756452 small insertion probably benign
R6747:Peg10 UTSW 6 4757137 utr 3 prime probably benign
R6775:Peg10 UTSW 6 4756452 small insertion probably benign
R6811:Peg10 UTSW 6 4756451 small insertion probably benign
R6823:Peg10 UTSW 6 4756431 small deletion probably benign
R6826:Peg10 UTSW 6 4756353 small insertion probably benign
R6847:Peg10 UTSW 6 4754279 utr 5 prime probably benign
R6861:Peg10 UTSW 6 4756350 small insertion probably benign
R6861:Peg10 UTSW 6 4756351 small insertion probably benign
R6876:Peg10 UTSW 6 4756451 small insertion probably benign
R6891:Peg10 UTSW 6 4756449 small insertion probably benign
R6911:Peg10 UTSW 6 4756452 small insertion probably benign
R6973:Peg10 UTSW 6 4756431 small deletion probably benign
R6990:Peg10 UTSW 6 4756451 small insertion probably benign
R6998:Peg10 UTSW 6 4756398 small deletion probably benign
R7070:Peg10 UTSW 6 4756454 small insertion probably benign
R7120:Peg10 UTSW 6 4756398 small deletion probably benign
R7132:Peg10 UTSW 6 4756398 small deletion probably benign
R7140:Peg10 UTSW 6 4756452 small insertion probably benign
R7189:Peg10 UTSW 6 4756431 small deletion probably benign
R7208:Peg10 UTSW 6 4756398 small deletion probably benign
R7256:Peg10 UTSW 6 4756398 small deletion probably benign
R7260:Peg10 UTSW 6 4756398 small deletion probably benign
R7261:Peg10 UTSW 6 4756591 missense unknown
R7401:Peg10 UTSW 6 4756452 small insertion probably benign
R7409:Peg10 UTSW 6 4756398 small deletion probably benign
R7439:Peg10 UTSW 6 4756453 small insertion probably benign
R7475:Peg10 UTSW 6 4756398 small deletion probably benign
R7483:Peg10 UTSW 6 4756451 small insertion probably benign
R7502:Peg10 UTSW 6 4756398 small deletion probably benign
R7515:Peg10 UTSW 6 4756452 small insertion probably benign
R7520:Peg10 UTSW 6 4756796 missense unknown
R7544:Peg10 UTSW 6 4756427 frame shift probably null
R7571:Peg10 UTSW 6 4756082 missense unknown
R7581:Peg10 UTSW 6 4756452 small insertion probably benign
R7635:Peg10 UTSW 6 4754938 missense probably damaging 0.99
R7677:Peg10 UTSW 6 4756398 small deletion probably benign
R7697:Peg10 UTSW 6 4756453 small insertion probably benign
R7710:Peg10 UTSW 6 4756452 small insertion probably benign
R7803:Peg10 UTSW 6 4756431 small deletion probably benign
R7816:Peg10 UTSW 6 4756453 small insertion probably benign
R7820:Peg10 UTSW 6 4756398 small deletion probably benign
R7827:Peg10 UTSW 6 4756452 small insertion probably benign
R7861:Peg10 UTSW 6 4756431 small deletion probably benign
R7881:Peg10 UTSW 6 4756454 small insertion probably benign
R7904:Peg10 UTSW 6 4756452 small insertion probably benign
R7915:Peg10 UTSW 6 4756451 small insertion probably benign
R7916:Peg10 UTSW 6 4756451 small insertion probably benign
R7963:Peg10 UTSW 6 4756452 small insertion probably benign
R8016:Peg10 UTSW 6 4756451 small insertion probably benign
R8037:Peg10 UTSW 6 4756398 small deletion probably benign
R8062:Peg10 UTSW 6 4756398 small deletion probably benign
R8081:Peg10 UTSW 6 4756452 small insertion probably benign
R8113:Peg10 UTSW 6 4756451 small insertion probably benign
R8115:Peg10 UTSW 6 4756707 missense unknown
R8140:Peg10 UTSW 6 4756113 missense unknown
R8178:Peg10 UTSW 6 4756452 small insertion probably benign
R8233:Peg10 UTSW 6 4756453 small insertion probably benign
R8281:Peg10 UTSW 6 4756431 small deletion probably benign
R8310:Peg10 UTSW 6 4756454 small insertion probably benign
R8312:Peg10 UTSW 6 4756452 small insertion probably benign
R8330:Peg10 UTSW 6 4756452 small insertion probably benign
R8338:Peg10 UTSW 6 4756398 small deletion probably benign
R8387:Peg10 UTSW 6 4756452 small insertion probably benign
R8390:Peg10 UTSW 6 4756451 small insertion probably benign
X0065:Peg10 UTSW 6 4756515 utr 3 prime probably benign
Z1176:Peg10 UTSW 6 4756451 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GTTTACAGTGCCACAACCG -3'
(R):5'- ACCTTACAGGGTGGTAAATTCTG -3'

Sequencing Primer
(F):5'- TCAGCATGAGCATCTGCATG -3'
(R):5'- GGTGGTAAATTCTGAATCCAGCC -3'
Posted On2020-07-13