Incidental Mutation 'R8239:Slc6a6'
ID637498
Institutional Source Beutler Lab
Gene Symbol Slc6a6
Ensembl Gene ENSMUSG00000030096
Gene Namesolute carrier family 6 (neurotransmitter transporter, taurine), member 6
SynonymsTaut
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8239 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location91684053-91759066 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91724970 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 120 (F120L)
Ref Sequence ENSEMBL: ENSMUSP00000032185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032185] [ENSMUST00000205480] [ENSMUST00000205828] [ENSMUST00000206545]
Predicted Effect probably benign
Transcript: ENSMUST00000032185
AA Change: F120L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000032185
Gene: ENSMUSG00000030096
AA Change: F120L

DomainStartEndE-ValueType
Pfam:SNF 41 568 1.2e-241 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205480
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000205828
Predicted Effect probably benign
Transcript: ENSMUST00000206545
AA Change: F120L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-pass membrane protein that is a member of a family of sodium and chloride-ion dependent transporters. The encoded protein transports taurine and beta-alanine. There is a pseudogene for this gene on chromosome 21. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous mutant mice have impaired vision associated with retinal degeneration. In addition to the visual defects, mutant mice exhibit reduced female fertility and decreased levels of taurine in a variety of tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T C 8: 40,825,069 S166P probably damaging Het
Appl1 T A 14: 26,964,957 T19S probably damaging Het
Arid4b T A 13: 14,170,009 D557E probably benign Het
Aven C T 2: 112,559,775 R8W probably benign Het
C2cd2l T C 9: 44,316,205 E307G possibly damaging Het
Cdh7 A C 1: 110,100,102 T526P probably benign Het
Dchs1 C T 7: 105,765,511 V775M probably benign Het
Dennd1b A G 1: 139,041,935 N63S probably benign Het
Dtnb A T 12: 3,644,056 Y248F unknown Het
Ehbp1l1 T A 19: 5,720,061 T405S possibly damaging Het
Fam149a A G 8: 45,350,453 Y415H possibly damaging Het
Fam186a A G 15: 99,941,310 L2351P unknown Het
Fsip2 T G 2: 82,989,343 I5140S possibly damaging Het
Gm8674 T C 13: 49,900,226 T749A noncoding transcript Het
Grasp C T 15: 101,231,021 L217F probably damaging Het
Inadl A G 4: 98,682,071 E1711G possibly damaging Het
Kalrn A G 16: 34,049,783 V1894A noncoding transcript Het
Kpna3 A T 14: 61,387,470 N141K probably damaging Het
Lrba G A 3: 86,542,575 G2067D probably damaging Het
Lrp2 G T 2: 69,481,267 Y2622* probably null Het
Lrtm2 A C 6: 119,320,817 F88V probably damaging Het
Mboat1 T C 13: 30,245,350 S454P probably damaging Het
Nkpd1 C T 7: 19,519,828 P40S probably benign Het
Olfr1065 C A 2: 86,445,129 M284I noncoding transcript Het
Olfr1249 T A 2: 89,630,563 I112F probably damaging Het
Olfr1535 T C 13: 21,555,618 I135V probably benign Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pcdha4 A T 18: 36,953,075 I104F probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Plekhg4 C T 8: 105,380,914 R990* probably null Het
Pphln1 T C 15: 93,489,049 S343P probably benign Het
Pram1 A T 17: 33,641,267 K269N probably damaging Het
Psmd13 T A 7: 140,886,537 I79K probably damaging Het
Ptprf T C 4: 118,212,112 D1586G possibly damaging Het
Ptprh T A 7: 4,581,091 Q167H probably damaging Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Rreb1 T C 13: 37,893,872 M20T probably damaging Het
Scrn2 T G 11: 97,032,220 L163R probably damaging Het
Slc36a3 C T 11: 55,131,607 V254I probably benign Het
Slc8a2 A T 7: 16,145,305 H572L probably benign Het
Spats2 T A 15: 99,208,895 D357E probably damaging Het
Speg A T 1: 75,419,033 N1816I probably damaging Het
Sult2b1 A G 7: 45,783,937 V2A unknown Het
Susd3 T C 13: 49,231,255 T231A probably benign Het
Tcp1 A G 17: 12,920,851 D261G probably benign Het
Trpm2 C G 10: 77,936,002 S601T probably benign Het
Ugt2b38 A T 5: 87,423,800 F124L probably benign Het
Unc80 G T 1: 66,654,019 E2522D probably benign Het
Usp34 A G 11: 23,446,750 T2365A Het
Vmn2r92 G T 17: 18,185,016 M807I probably benign Het
Vps13b C A 15: 35,597,404 P1030Q probably damaging Het
Wrn T G 8: 33,329,185 K246N probably damaging Het
Zer1 T A 2: 30,101,135 probably null Het
Other mutations in Slc6a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00800:Slc6a6 APN 6 91741170 intron probably benign
IGL01829:Slc6a6 APN 6 91735189 missense probably damaging 1.00
IGL01896:Slc6a6 APN 6 91726069 missense probably damaging 0.97
IGL02087:Slc6a6 APN 6 91735179 missense probably benign
IGL02301:Slc6a6 APN 6 91726056 missense probably benign 0.31
IGL02439:Slc6a6 APN 6 91749827 missense probably damaging 0.99
IGL02555:Slc6a6 APN 6 91748330 unclassified probably benign
animas UTSW 6 91740014 splice site probably null
durango UTSW 6 91723471 missense probably damaging 1.00
R0530:Slc6a6 UTSW 6 91724958 missense probably null 0.04
R1327:Slc6a6 UTSW 6 91726035 missense probably benign 0.00
R1503:Slc6a6 UTSW 6 91740992 missense probably damaging 1.00
R1612:Slc6a6 UTSW 6 91741027 missense probably damaging 1.00
R2033:Slc6a6 UTSW 6 91724910 missense probably benign 0.12
R2146:Slc6a6 UTSW 6 91735180 missense probably benign 0.05
R2309:Slc6a6 UTSW 6 91726196 missense possibly damaging 0.63
R2434:Slc6a6 UTSW 6 91735212 missense probably benign 0.33
R2656:Slc6a6 UTSW 6 91741048 missense probably damaging 1.00
R3402:Slc6a6 UTSW 6 91726129 missense probably benign
R3403:Slc6a6 UTSW 6 91726129 missense probably benign
R3978:Slc6a6 UTSW 6 91755052 missense probably benign 0.41
R4236:Slc6a6 UTSW 6 91741276 missense probably damaging 0.98
R4332:Slc6a6 UTSW 6 91723471 missense probably damaging 1.00
R4980:Slc6a6 UTSW 6 91726060 missense probably damaging 1.00
R5326:Slc6a6 UTSW 6 91735189 missense probably damaging 1.00
R5358:Slc6a6 UTSW 6 91735174 missense probably benign 0.28
R5542:Slc6a6 UTSW 6 91735189 missense probably damaging 1.00
R5774:Slc6a6 UTSW 6 91745000 missense probably damaging 1.00
R5839:Slc6a6 UTSW 6 91723317 missense probably damaging 1.00
R5861:Slc6a6 UTSW 6 91741033 missense probably damaging 1.00
R5939:Slc6a6 UTSW 6 91754948 missense probably benign 0.01
R6160:Slc6a6 UTSW 6 91740014 splice site probably null
R6262:Slc6a6 UTSW 6 91755032 missense possibly damaging 0.66
R6265:Slc6a6 UTSW 6 91754915 missense probably damaging 0.99
R6665:Slc6a6 UTSW 6 91726039 missense probably benign 0.38
R6998:Slc6a6 UTSW 6 91752438 missense probably benign 0.21
R7057:Slc6a6 UTSW 6 91741267 missense probably damaging 1.00
R7568:Slc6a6 UTSW 6 91724851 missense probably damaging 1.00
R7768:Slc6a6 UTSW 6 91739965 missense probably damaging 0.99
R8042:Slc6a6 UTSW 6 91741245 missense probably benign 0.11
R8125:Slc6a6 UTSW 6 91726106 missense probably damaging 0.97
R8194:Slc6a6 UTSW 6 91740971 missense probably damaging 1.00
R8343:Slc6a6 UTSW 6 91726243 nonsense probably null
R8363:Slc6a6 UTSW 6 91750296 missense probably benign 0.03
X0002:Slc6a6 UTSW 6 91723476 missense probably damaging 1.00
X0063:Slc6a6 UTSW 6 91741224 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACCTTTGCTTGGGAGGGC -3'
(R):5'- GTCAGGAACCTGCTGTATCTC -3'

Sequencing Primer
(F):5'- GCTTGGGAGTGAGCACCTC -3'
(R):5'- AGGAACCTGCTGTATCTCCCTTC -3'
Posted On2020-07-13