Incidental Mutation 'R8239:Slc8a2'
ID637501
Institutional Source Beutler Lab
Gene Symbol Slc8a2
Ensembl Gene ENSMUSG00000030376
Gene Namesolute carrier family 8 (sodium/calcium exchanger), member 2
SynonymsNcx2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R8239 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location16129826-16161063 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 16145305 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 572 (H572L)
Ref Sequence ENSEMBL: ENSMUSP00000128926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168693] [ENSMUST00000211649]
Predicted Effect probably benign
Transcript: ENSMUST00000168693
AA Change: H572L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000128926
Gene: ENSMUSG00000030376
AA Change: H572L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 23 32 N/A INTRINSIC
Pfam:Na_Ca_ex 74 245 8.6e-35 PFAM
Pfam:Na_Ca_ex_C 248 378 7.8e-50 PFAM
Calx_beta 383 483 3.27e-47 SMART
Calx_beta 512 612 3.37e-49 SMART
low complexity region 704 717 N/A INTRINSIC
Pfam:Na_Ca_ex 747 912 2.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211649
AA Change: H572L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: The clearance of elevated calcium following depolarization is delayed in homozygous mutant mice, which exhibit enhanced learning and memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T C 8: 40,825,069 S166P probably damaging Het
Appl1 T A 14: 26,964,957 T19S probably damaging Het
Arid4b T A 13: 14,170,009 D557E probably benign Het
Aven C T 2: 112,559,775 R8W probably benign Het
C2cd2l T C 9: 44,316,205 E307G possibly damaging Het
Cdh7 A C 1: 110,100,102 T526P probably benign Het
Dchs1 C T 7: 105,765,511 V775M probably benign Het
Dennd1b A G 1: 139,041,935 N63S probably benign Het
Dtnb A T 12: 3,644,056 Y248F unknown Het
Ehbp1l1 T A 19: 5,720,061 T405S possibly damaging Het
Fam149a A G 8: 45,350,453 Y415H possibly damaging Het
Fam186a A G 15: 99,941,310 L2351P unknown Het
Fsip2 T G 2: 82,989,343 I5140S possibly damaging Het
Gm8674 T C 13: 49,900,226 T749A noncoding transcript Het
Grasp C T 15: 101,231,021 L217F probably damaging Het
Inadl A G 4: 98,682,071 E1711G possibly damaging Het
Kalrn A G 16: 34,049,783 V1894A noncoding transcript Het
Kpna3 A T 14: 61,387,470 N141K probably damaging Het
Lrba G A 3: 86,542,575 G2067D probably damaging Het
Lrp2 G T 2: 69,481,267 Y2622* probably null Het
Lrtm2 A C 6: 119,320,817 F88V probably damaging Het
Mboat1 T C 13: 30,245,350 S454P probably damaging Het
Nkpd1 C T 7: 19,519,828 P40S probably benign Het
Olfr1065 C A 2: 86,445,129 M284I noncoding transcript Het
Olfr1249 T A 2: 89,630,563 I112F probably damaging Het
Olfr1535 T C 13: 21,555,618 I135V probably benign Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pcdha4 A T 18: 36,953,075 I104F probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Plekhg4 C T 8: 105,380,914 R990* probably null Het
Pphln1 T C 15: 93,489,049 S343P probably benign Het
Pram1 A T 17: 33,641,267 K269N probably damaging Het
Psmd13 T A 7: 140,886,537 I79K probably damaging Het
Ptprf T C 4: 118,212,112 D1586G possibly damaging Het
Ptprh T A 7: 4,581,091 Q167H probably damaging Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Rreb1 T C 13: 37,893,872 M20T probably damaging Het
Scrn2 T G 11: 97,032,220 L163R probably damaging Het
Slc36a3 C T 11: 55,131,607 V254I probably benign Het
Slc6a6 T C 6: 91,724,970 F120L probably benign Het
Spats2 T A 15: 99,208,895 D357E probably damaging Het
Speg A T 1: 75,419,033 N1816I probably damaging Het
Sult2b1 A G 7: 45,783,937 V2A unknown Het
Susd3 T C 13: 49,231,255 T231A probably benign Het
Tcp1 A G 17: 12,920,851 D261G probably benign Het
Trpm2 C G 10: 77,936,002 S601T probably benign Het
Ugt2b38 A T 5: 87,423,800 F124L probably benign Het
Unc80 G T 1: 66,654,019 E2522D probably benign Het
Usp34 A G 11: 23,446,750 T2365A Het
Vmn2r92 G T 17: 18,185,016 M807I probably benign Het
Vps13b C A 15: 35,597,404 P1030Q probably damaging Het
Wrn T G 8: 33,329,185 K246N probably damaging Het
Zer1 T A 2: 30,101,135 probably null Het
Other mutations in Slc8a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Slc8a2 APN 7 16158893 missense probably damaging 1.00
IGL02097:Slc8a2 APN 7 16157156 missense possibly damaging 0.88
IGL02744:Slc8a2 APN 7 16145029 missense possibly damaging 0.91
PIT4402001:Slc8a2 UTSW 7 16134494 missense probably damaging 1.00
PIT4515001:Slc8a2 UTSW 7 16140579 missense possibly damaging 0.69
R0281:Slc8a2 UTSW 7 16140989 missense probably benign
R0513:Slc8a2 UTSW 7 16157339 missense probably damaging 1.00
R0811:Slc8a2 UTSW 7 16141114 missense probably damaging 1.00
R0812:Slc8a2 UTSW 7 16141114 missense probably damaging 1.00
R0940:Slc8a2 UTSW 7 16144962 missense probably benign 0.04
R1167:Slc8a2 UTSW 7 16157387 missense possibly damaging 0.58
R1508:Slc8a2 UTSW 7 16140597 missense probably benign 0.00
R1655:Slc8a2 UTSW 7 16141135 missense probably damaging 1.00
R1917:Slc8a2 UTSW 7 16152920 missense probably benign 0.11
R1919:Slc8a2 UTSW 7 16152920 missense probably benign 0.11
R2051:Slc8a2 UTSW 7 16141015 missense probably damaging 1.00
R2083:Slc8a2 UTSW 7 16134515 missense probably damaging 1.00
R2128:Slc8a2 UTSW 7 16140492 splice site probably null
R2149:Slc8a2 UTSW 7 16159164 missense probably damaging 1.00
R3437:Slc8a2 UTSW 7 16158885 missense probably damaging 1.00
R3618:Slc8a2 UTSW 7 16152899 missense possibly damaging 0.48
R4645:Slc8a2 UTSW 7 16134239 missense probably damaging 1.00
R4741:Slc8a2 UTSW 7 16134308 missense probably damaging 1.00
R4936:Slc8a2 UTSW 7 16134175 nonsense probably null
R5071:Slc8a2 UTSW 7 16150583 missense possibly damaging 0.84
R5072:Slc8a2 UTSW 7 16150583 missense possibly damaging 0.84
R5074:Slc8a2 UTSW 7 16150583 missense possibly damaging 0.84
R5150:Slc8a2 UTSW 7 16145176 missense possibly damaging 0.74
R5358:Slc8a2 UTSW 7 16157303 missense probably damaging 1.00
R5839:Slc8a2 UTSW 7 16134487 missense probably damaging 1.00
R5957:Slc8a2 UTSW 7 16145284 missense possibly damaging 0.90
R6273:Slc8a2 UTSW 7 16145334 missense possibly damaging 0.94
R6363:Slc8a2 UTSW 7 16134045 missense probably benign 0.00
R6881:Slc8a2 UTSW 7 16157357 missense probably damaging 1.00
R7084:Slc8a2 UTSW 7 16145038 missense probably benign 0.17
R7211:Slc8a2 UTSW 7 16140613 missense possibly damaging 0.87
R7227:Slc8a2 UTSW 7 16144981 missense possibly damaging 0.73
R7278:Slc8a2 UTSW 7 16141152 missense probably damaging 1.00
R7380:Slc8a2 UTSW 7 16134353 missense probably damaging 1.00
Z1177:Slc8a2 UTSW 7 16140987 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TGAGCACTTCTTCGTGAGGC -3'
(R):5'- ATCGCCTGCTAGGGTTATTC -3'

Sequencing Primer
(F):5'- TCTTCGTGAGGCTGCTGAACC -3'
(R):5'- TCTGTAGACCAGGCTCACAGAG -3'
Posted On2020-07-13