Incidental Mutation 'R8239:Sult2b1'
ID637503
Institutional Source Beutler Lab
Gene Symbol Sult2b1
Ensembl Gene ENSMUSG00000003271
Gene Namesulfotransferase family, cytosolic, 2B, member 1
SynonymsSULT2B
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R8239 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location45729983-45784669 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45783937 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 2 (V2A)
Ref Sequence ENSEMBL: ENSMUSP00000147374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072580] [ENSMUST00000120005] [ENSMUST00000209617] [ENSMUST00000209701] [ENSMUST00000209739] [ENSMUST00000211609]
Predicted Effect probably benign
Transcript: ENSMUST00000072580
SMART Domains Protein: ENSMUSP00000072388
Gene: ENSMUSG00000062044

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
Pfam:Pkinase 133 408 8.3e-37 PFAM
Pfam:Pkinase_Tyr 133 408 4.9e-64 PFAM
low complexity region 415 444 N/A INTRINSIC
low complexity region 484 506 N/A INTRINSIC
low complexity region 599 609 N/A INTRINSIC
low complexity region 639 669 N/A INTRINSIC
low complexity region 735 791 N/A INTRINSIC
low complexity region 797 843 N/A INTRINSIC
low complexity region 1081 1105 N/A INTRINSIC
low complexity region 1116 1132 N/A INTRINSIC
low complexity region 1196 1223 N/A INTRINSIC
low complexity region 1225 1263 N/A INTRINSIC
low complexity region 1345 1362 N/A INTRINSIC
low complexity region 1384 1393 N/A INTRINSIC
low complexity region 1407 1421 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120005
SMART Domains Protein: ENSMUSP00000112592
Gene: ENSMUSG00000062044

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
Pfam:Pkinase 133 408 8.3e-37 PFAM
Pfam:Pkinase_Tyr 133 408 4.9e-64 PFAM
low complexity region 415 444 N/A INTRINSIC
low complexity region 484 506 N/A INTRINSIC
low complexity region 599 609 N/A INTRINSIC
low complexity region 639 669 N/A INTRINSIC
low complexity region 735 791 N/A INTRINSIC
low complexity region 797 843 N/A INTRINSIC
low complexity region 1081 1105 N/A INTRINSIC
low complexity region 1116 1132 N/A INTRINSIC
low complexity region 1196 1223 N/A INTRINSIC
low complexity region 1225 1263 N/A INTRINSIC
low complexity region 1345 1362 N/A INTRINSIC
low complexity region 1384 1393 N/A INTRINSIC
low complexity region 1407 1421 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209351
Predicted Effect probably benign
Transcript: ENSMUST00000209617
Predicted Effect probably benign
Transcript: ENSMUST00000209701
Predicted Effect unknown
Transcript: ENSMUST00000209739
AA Change: V2A
Predicted Effect probably benign
Transcript: ENSMUST00000211127
Predicted Effect probably benign
Transcript: ENSMUST00000211609
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene sulfates dehydroepiandrosterone but not 4-nitrophenol, a typical substrate for the phenol and estrogen sulfotransferase subfamilies. Two alternatively spliced variants that encode different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele lack cholesterol sulfate in the dermis but otherwise appear to have normal lipid metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T C 8: 40,825,069 S166P probably damaging Het
Appl1 T A 14: 26,964,957 T19S probably damaging Het
Arid4b T A 13: 14,170,009 D557E probably benign Het
Aven C T 2: 112,559,775 R8W probably benign Het
C2cd2l T C 9: 44,316,205 E307G possibly damaging Het
Cdh7 A C 1: 110,100,102 T526P probably benign Het
Dchs1 C T 7: 105,765,511 V775M probably benign Het
Dennd1b A G 1: 139,041,935 N63S probably benign Het
Dtnb A T 12: 3,644,056 Y248F unknown Het
Ehbp1l1 T A 19: 5,720,061 T405S possibly damaging Het
Fam149a A G 8: 45,350,453 Y415H possibly damaging Het
Fam186a A G 15: 99,941,310 L2351P unknown Het
Fsip2 T G 2: 82,989,343 I5140S possibly damaging Het
Gm8674 T C 13: 49,900,226 T749A noncoding transcript Het
Grasp C T 15: 101,231,021 L217F probably damaging Het
Inadl A G 4: 98,682,071 E1711G possibly damaging Het
Kalrn A G 16: 34,049,783 V1894A noncoding transcript Het
Kpna3 A T 14: 61,387,470 N141K probably damaging Het
Lrba G A 3: 86,542,575 G2067D probably damaging Het
Lrp2 G T 2: 69,481,267 Y2622* probably null Het
Lrtm2 A C 6: 119,320,817 F88V probably damaging Het
Mboat1 T C 13: 30,245,350 S454P probably damaging Het
Nkpd1 C T 7: 19,519,828 P40S probably benign Het
Olfr1065 C A 2: 86,445,129 M284I noncoding transcript Het
Olfr1249 T A 2: 89,630,563 I112F probably damaging Het
Olfr1535 T C 13: 21,555,618 I135V probably benign Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pcdha4 A T 18: 36,953,075 I104F probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Plekhg4 C T 8: 105,380,914 R990* probably null Het
Pphln1 T C 15: 93,489,049 S343P probably benign Het
Pram1 A T 17: 33,641,267 K269N probably damaging Het
Psmd13 T A 7: 140,886,537 I79K probably damaging Het
Ptprf T C 4: 118,212,112 D1586G possibly damaging Het
Ptprh T A 7: 4,581,091 Q167H probably damaging Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Rreb1 T C 13: 37,893,872 M20T probably damaging Het
Scrn2 T G 11: 97,032,220 L163R probably damaging Het
Slc36a3 C T 11: 55,131,607 V254I probably benign Het
Slc6a6 T C 6: 91,724,970 F120L probably benign Het
Slc8a2 A T 7: 16,145,305 H572L probably benign Het
Spats2 T A 15: 99,208,895 D357E probably damaging Het
Speg A T 1: 75,419,033 N1816I probably damaging Het
Susd3 T C 13: 49,231,255 T231A probably benign Het
Tcp1 A G 17: 12,920,851 D261G probably benign Het
Trpm2 C G 10: 77,936,002 S601T probably benign Het
Ugt2b38 A T 5: 87,423,800 F124L probably benign Het
Unc80 G T 1: 66,654,019 E2522D probably benign Het
Usp34 A G 11: 23,446,750 T2365A Het
Vmn2r92 G T 17: 18,185,016 M807I probably benign Het
Vps13b C A 15: 35,597,404 P1030Q probably damaging Het
Wrn T G 8: 33,329,185 K246N probably damaging Het
Zer1 T A 2: 30,101,135 probably null Het
Other mutations in Sult2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02415:Sult2b1 APN 7 45742085 missense possibly damaging 0.86
IGL02964:Sult2b1 APN 7 45735274 missense probably benign 0.01
IGL03208:Sult2b1 APN 7 45733629 missense probably damaging 1.00
R0392:Sult2b1 UTSW 7 45733638 missense probably damaging 1.00
R0415:Sult2b1 UTSW 7 45730092 unclassified probably benign
R2247:Sult2b1 UTSW 7 45735310 missense probably damaging 1.00
R3851:Sult2b1 UTSW 7 45730037 unclassified probably benign
R3935:Sult2b1 UTSW 7 45742216 missense probably benign 0.09
R3936:Sult2b1 UTSW 7 45742216 missense probably benign 0.09
R4179:Sult2b1 UTSW 7 45735311 missense probably damaging 1.00
R4723:Sult2b1 UTSW 7 45742065 missense probably damaging 1.00
R5634:Sult2b1 UTSW 7 45734082 missense probably damaging 0.99
R5782:Sult2b1 UTSW 7 45731346 missense probably damaging 1.00
R6562:Sult2b1 UTSW 7 45742246 missense probably benign 0.00
R6816:Sult2b1 UTSW 7 45733678 missense probably damaging 1.00
R6921:Sult2b1 UTSW 7 45735188 missense probably damaging 1.00
R7145:Sult2b1 UTSW 7 45733632 missense probably damaging 1.00
R7250:Sult2b1 UTSW 7 45783937 missense unknown
R7392:Sult2b1 UTSW 7 45742438 start gained probably benign
R7398:Sult2b1 UTSW 7 45731294 missense probably damaging 1.00
R7691:Sult2b1 UTSW 7 45735284 missense probably benign 0.01
R7712:Sult2b1 UTSW 7 45730196 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- GGTCACTGCAATCCCATTCC -3'
(R):5'- CACATGGGCACAAAAGATGC -3'

Sequencing Primer
(F):5'- ACTGCAATCCCATTCCCTGTAC -3'
(R):5'- CAGGCGTTTCCCAAGATTTACAG -3'
Posted On2020-07-13