Incidental Mutation 'R8239:Psmd13'
ID637505
Institutional Source Beutler Lab
Gene Symbol Psmd13
Ensembl Gene ENSMUSG00000025487
Gene Nameproteasome (prosome, macropain) 26S subunit, non-ATPase, 13
Synonyms26S proteasome subunit p40.5, S11
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R8239 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location140881968-140898643 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 140886537 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 79 (I79K)
Ref Sequence ENSEMBL: ENSMUSP00000026560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026559] [ENSMUST00000026560] [ENSMUST00000106048] [ENSMUST00000137710] [ENSMUST00000147331] [ENSMUST00000163610] [ENSMUST00000164681] [ENSMUST00000166889] [ENSMUST00000210296] [ENSMUST00000211179]
Predicted Effect probably benign
Transcript: ENSMUST00000026559
SMART Domains Protein: ENSMUSP00000026559
Gene: ENSMUSG00000025486

DomainStartEndE-ValueType
Pfam:SIR2 3 184 5.3e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000026560
AA Change: I79K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026560
Gene: ENSMUSG00000025487
AA Change: I79K

DomainStartEndE-ValueType
low complexity region 9 14 N/A INTRINSIC
PINT 263 356 2.26e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106048
SMART Domains Protein: ENSMUSP00000101663
Gene: ENSMUSG00000025486

DomainStartEndE-ValueType
Pfam:SIR2 3 184 8.7e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130462
SMART Domains Protein: ENSMUSP00000126160
Gene: ENSMUSG00000025487

DomainStartEndE-ValueType
PINT 100 189 6.59e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137710
SMART Domains Protein: ENSMUSP00000115202
Gene: ENSMUSG00000025486

DomainStartEndE-ValueType
Pfam:SIR2 3 99 1.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147331
SMART Domains Protein: ENSMUSP00000121151
Gene: ENSMUSG00000025486

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
Pfam:SIR2 80 258 1.9e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163610
AA Change: I79K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130580
Gene: ENSMUSG00000025487
AA Change: I79K

DomainStartEndE-ValueType
low complexity region 9 14 N/A INTRINSIC
PDB:4CR4|O 16 347 7e-44 PDB
Blast:PINT 245 329 9e-26 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000164681
AA Change: I79K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132405
Gene: ENSMUSG00000025487
AA Change: I79K

DomainStartEndE-ValueType
low complexity region 9 14 N/A INTRINSIC
PDB:4CR4|O 16 184 1e-12 PDB
low complexity region 217 232 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166889
AA Change: N67K

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126532
Gene: ENSMUSG00000025487
AA Change: N67K

DomainStartEndE-ValueType
low complexity region 9 14 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210296
Predicted Effect probably benign
Transcript: ENSMUST00000211179
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a non-ATPase subunit of the 19S regulator. Two transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T C 8: 40,825,069 S166P probably damaging Het
Appl1 T A 14: 26,964,957 T19S probably damaging Het
Arid4b T A 13: 14,170,009 D557E probably benign Het
Aven C T 2: 112,559,775 R8W probably benign Het
C2cd2l T C 9: 44,316,205 E307G possibly damaging Het
Cdh7 A C 1: 110,100,102 T526P probably benign Het
Dchs1 C T 7: 105,765,511 V775M probably benign Het
Dennd1b A G 1: 139,041,935 N63S probably benign Het
Dtnb A T 12: 3,644,056 Y248F unknown Het
Ehbp1l1 T A 19: 5,720,061 T405S possibly damaging Het
Fam149a A G 8: 45,350,453 Y415H possibly damaging Het
Fam186a A G 15: 99,941,310 L2351P unknown Het
Fsip2 T G 2: 82,989,343 I5140S possibly damaging Het
Gm8674 T C 13: 49,900,226 T749A noncoding transcript Het
Grasp C T 15: 101,231,021 L217F probably damaging Het
Inadl A G 4: 98,682,071 E1711G possibly damaging Het
Kalrn A G 16: 34,049,783 V1894A noncoding transcript Het
Kpna3 A T 14: 61,387,470 N141K probably damaging Het
Lrba G A 3: 86,542,575 G2067D probably damaging Het
Lrp2 G T 2: 69,481,267 Y2622* probably null Het
Lrtm2 A C 6: 119,320,817 F88V probably damaging Het
Mboat1 T C 13: 30,245,350 S454P probably damaging Het
Nkpd1 C T 7: 19,519,828 P40S probably benign Het
Olfr1065 C A 2: 86,445,129 M284I noncoding transcript Het
Olfr1249 T A 2: 89,630,563 I112F probably damaging Het
Olfr1535 T C 13: 21,555,618 I135V probably benign Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pcdha4 A T 18: 36,953,075 I104F probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Plekhg4 C T 8: 105,380,914 R990* probably null Het
Pphln1 T C 15: 93,489,049 S343P probably benign Het
Pram1 A T 17: 33,641,267 K269N probably damaging Het
Ptprf T C 4: 118,212,112 D1586G possibly damaging Het
Ptprh T A 7: 4,581,091 Q167H probably damaging Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Rreb1 T C 13: 37,893,872 M20T probably damaging Het
Scrn2 T G 11: 97,032,220 L163R probably damaging Het
Slc36a3 C T 11: 55,131,607 V254I probably benign Het
Slc6a6 T C 6: 91,724,970 F120L probably benign Het
Slc8a2 A T 7: 16,145,305 H572L probably benign Het
Spats2 T A 15: 99,208,895 D357E probably damaging Het
Speg A T 1: 75,419,033 N1816I probably damaging Het
Sult2b1 A G 7: 45,783,937 V2A unknown Het
Susd3 T C 13: 49,231,255 T231A probably benign Het
Tcp1 A G 17: 12,920,851 D261G probably benign Het
Trpm2 C G 10: 77,936,002 S601T probably benign Het
Ugt2b38 A T 5: 87,423,800 F124L probably benign Het
Unc80 G T 1: 66,654,019 E2522D probably benign Het
Usp34 A G 11: 23,446,750 T2365A Het
Vmn2r92 G T 17: 18,185,016 M807I probably benign Het
Vps13b C A 15: 35,597,404 P1030Q probably damaging Het
Wrn T G 8: 33,329,185 K246N probably damaging Het
Zer1 T A 2: 30,101,135 probably null Het
Other mutations in Psmd13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Psmd13 APN 7 140897621 missense probably damaging 0.97
IGL02265:Psmd13 APN 7 140882518 missense probably damaging 1.00
R0326:Psmd13 UTSW 7 140897711 missense probably damaging 1.00
R1163:Psmd13 UTSW 7 140897454 missense probably damaging 0.97
R1667:Psmd13 UTSW 7 140890609 missense probably damaging 1.00
R1721:Psmd13 UTSW 7 140883517 missense probably damaging 1.00
R1867:Psmd13 UTSW 7 140883517 missense probably damaging 1.00
R1993:Psmd13 UTSW 7 140898194 missense probably damaging 1.00
R2070:Psmd13 UTSW 7 140897648 missense probably damaging 0.99
R2844:Psmd13 UTSW 7 140897740 intron probably benign
R2845:Psmd13 UTSW 7 140897740 intron probably benign
R2846:Psmd13 UTSW 7 140897740 intron probably benign
R2869:Psmd13 UTSW 7 140887055 missense probably damaging 0.99
R2869:Psmd13 UTSW 7 140887055 missense probably damaging 0.99
R2871:Psmd13 UTSW 7 140887055 missense probably damaging 0.99
R2871:Psmd13 UTSW 7 140887055 missense probably damaging 0.99
R4358:Psmd13 UTSW 7 140889505 intron probably benign
R4973:Psmd13 UTSW 7 140886853 nonsense probably null
R5197:Psmd13 UTSW 7 140894461 splice site probably null
R6700:Psmd13 UTSW 7 140890609 missense probably damaging 1.00
Z1176:Psmd13 UTSW 7 140882426 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ATGCAGCTTCTGGAGTCTGG -3'
(R):5'- AAGCAGTTAACAGTTCCCTCTCTC -3'

Sequencing Primer
(F):5'- GGGCTCGTGCTGTACTAATTCTC -3'
(R):5'- CTCTCTCCGATCATTACAAAAATCTC -3'
Posted On2020-07-13