Incidental Mutation 'R8239:Adam39'
ID637507
Institutional Source Beutler Lab
Gene Symbol Adam39
Ensembl Gene ENSMUSG00000054033
Gene Namea disintegrin and metallopeptidase domain 39
Synonyms1700056P18Rik, testase 9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R8239 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location40822990-40827037 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40825069 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 166 (S166P)
Ref Sequence ENSEMBL: ENSMUSP00000065783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066814]
Predicted Effect probably damaging
Transcript: ENSMUST00000066814
AA Change: S166P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065783
Gene: ENSMUSG00000054033
AA Change: S166P

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 53 178 1.3e-19 PFAM
Pfam:Reprolysin_5 219 398 2.2e-18 PFAM
Pfam:Reprolysin_4 219 406 6.8e-16 PFAM
Pfam:Reprolysin 221 410 1.3e-43 PFAM
Pfam:Reprolysin_2 238 399 2.6e-12 PFAM
Pfam:Reprolysin_3 246 366 1.2e-17 PFAM
DISIN 428 503 3.97e-37 SMART
ACR 504 640 8.95e-74 SMART
transmembrane domain 702 724 N/A INTRINSIC
low complexity region 734 745 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Appl1 T A 14: 26,964,957 T19S probably damaging Het
Arid4b T A 13: 14,170,009 D557E probably benign Het
Aven C T 2: 112,559,775 R8W probably benign Het
C2cd2l T C 9: 44,316,205 E307G possibly damaging Het
Cdh7 A C 1: 110,100,102 T526P probably benign Het
Dchs1 C T 7: 105,765,511 V775M probably benign Het
Dennd1b A G 1: 139,041,935 N63S probably benign Het
Dtnb A T 12: 3,644,056 Y248F unknown Het
Ehbp1l1 T A 19: 5,720,061 T405S possibly damaging Het
Fam149a A G 8: 45,350,453 Y415H possibly damaging Het
Fam186a A G 15: 99,941,310 L2351P unknown Het
Fsip2 T G 2: 82,989,343 I5140S possibly damaging Het
Gm8674 T C 13: 49,900,226 T749A noncoding transcript Het
Grasp C T 15: 101,231,021 L217F probably damaging Het
Inadl A G 4: 98,682,071 E1711G possibly damaging Het
Kalrn A G 16: 34,049,783 V1894A noncoding transcript Het
Kpna3 A T 14: 61,387,470 N141K probably damaging Het
Lrba G A 3: 86,542,575 G2067D probably damaging Het
Lrp2 G T 2: 69,481,267 Y2622* probably null Het
Lrtm2 A C 6: 119,320,817 F88V probably damaging Het
Mboat1 T C 13: 30,245,350 S454P probably damaging Het
Nkpd1 C T 7: 19,519,828 P40S probably benign Het
Olfr1065 C A 2: 86,445,129 M284I noncoding transcript Het
Olfr1249 T A 2: 89,630,563 I112F probably damaging Het
Olfr1535 T C 13: 21,555,618 I135V probably benign Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pcdha4 A T 18: 36,953,075 I104F probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Plekhg4 C T 8: 105,380,914 R990* probably null Het
Pphln1 T C 15: 93,489,049 S343P probably benign Het
Pram1 A T 17: 33,641,267 K269N probably damaging Het
Psmd13 T A 7: 140,886,537 I79K probably damaging Het
Ptprf T C 4: 118,212,112 D1586G possibly damaging Het
Ptprh T A 7: 4,581,091 Q167H probably damaging Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Rreb1 T C 13: 37,893,872 M20T probably damaging Het
Scrn2 T G 11: 97,032,220 L163R probably damaging Het
Slc36a3 C T 11: 55,131,607 V254I probably benign Het
Slc6a6 T C 6: 91,724,970 F120L probably benign Het
Slc8a2 A T 7: 16,145,305 H572L probably benign Het
Spats2 T A 15: 99,208,895 D357E probably damaging Het
Speg A T 1: 75,419,033 N1816I probably damaging Het
Sult2b1 A G 7: 45,783,937 V2A unknown Het
Susd3 T C 13: 49,231,255 T231A probably benign Het
Tcp1 A G 17: 12,920,851 D261G probably benign Het
Trpm2 C G 10: 77,936,002 S601T probably benign Het
Ugt2b38 A T 5: 87,423,800 F124L probably benign Het
Unc80 G T 1: 66,654,019 E2522D probably benign Het
Usp34 A G 11: 23,446,750 T2365A Het
Vmn2r92 G T 17: 18,185,016 M807I probably benign Het
Vps13b C A 15: 35,597,404 P1030Q probably damaging Het
Wrn T G 8: 33,329,185 K246N probably damaging Het
Zer1 T A 2: 30,101,135 probably null Het
Other mutations in Adam39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Adam39 APN 8 40826746 missense possibly damaging 0.53
IGL01350:Adam39 APN 8 40825839 nonsense probably null
IGL02237:Adam39 APN 8 40825445 missense probably benign 0.39
IGL02688:Adam39 APN 8 40826320 missense probably benign 0.00
IGL02890:Adam39 APN 8 40825153 missense probably benign 0.03
IGL03071:Adam39 APN 8 40825067 missense probably benign 0.08
IGL03145:Adam39 APN 8 40824658 missense probably benign 0.00
R0083:Adam39 UTSW 8 40825078 missense probably damaging 0.98
R0086:Adam39 UTSW 8 40826360 missense possibly damaging 0.64
R0546:Adam39 UTSW 8 40826431 missense probably damaging 1.00
R0548:Adam39 UTSW 8 40826467 missense probably damaging 1.00
R1489:Adam39 UTSW 8 40824994 missense possibly damaging 0.49
R1643:Adam39 UTSW 8 40826486 missense possibly damaging 0.83
R1756:Adam39 UTSW 8 40825324 missense probably damaging 0.99
R2081:Adam39 UTSW 8 40826842 makesense probably null
R4510:Adam39 UTSW 8 40826291 missense probably damaging 1.00
R4511:Adam39 UTSW 8 40826291 missense probably damaging 1.00
R4612:Adam39 UTSW 8 40825921 missense probably damaging 0.96
R4673:Adam39 UTSW 8 40824731 missense probably benign 0.37
R4704:Adam39 UTSW 8 40825796 missense probably benign
R4978:Adam39 UTSW 8 40825337 missense possibly damaging 0.49
R5116:Adam39 UTSW 8 40825001 missense probably damaging 1.00
R5269:Adam39 UTSW 8 40825981 missense probably benign 0.01
R5710:Adam39 UTSW 8 40824647 missense probably benign 0.05
R5971:Adam39 UTSW 8 40824593 missense probably benign 0.01
R6067:Adam39 UTSW 8 40824593 missense probably benign 0.01
R6078:Adam39 UTSW 8 40824593 missense probably benign 0.01
R6180:Adam39 UTSW 8 40826573 missense probably benign 0.03
R6358:Adam39 UTSW 8 40826681 missense probably benign 0.16
R6699:Adam39 UTSW 8 40826657 missense probably benign 0.01
R6896:Adam39 UTSW 8 40824938 missense possibly damaging 0.86
R7117:Adam39 UTSW 8 40826242 missense probably damaging 1.00
R7186:Adam39 UTSW 8 40826312 missense probably damaging 1.00
R7195:Adam39 UTSW 8 40824775 nonsense probably null
R7381:Adam39 UTSW 8 40825963 missense probably damaging 1.00
R7405:Adam39 UTSW 8 40824622 missense probably benign 0.01
R8068:Adam39 UTSW 8 40825938 missense not run
R8205:Adam39 UTSW 8 40825043 missense probably benign 0.06
U15987:Adam39 UTSW 8 40824593 missense probably benign 0.01
Z1177:Adam39 UTSW 8 40825295 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTATAGCCTGCATTTTGGGG -3'
(R):5'- AGAAAACTCCTGTGGGTCCAC -3'

Sequencing Primer
(F):5'- GGGGGCCAGAAACATTTTATTCAC -3'
(R):5'- GGGTCCACCATCCTTCATAGTG -3'
Posted On2020-07-13