Incidental Mutation 'R8239:Plekhg4'
ID637509
Institutional Source Beutler Lab
Gene Symbol Plekhg4
Ensembl Gene ENSMUSG00000014782
Gene Namepleckstrin homology domain containing, family G (with RhoGef domain) member 4
Synonyms4931414L13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R8239 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location105373274-105382862 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 105380914 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 990 (R990*)
Ref Sequence ENSEMBL: ENSMUSP00000014927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014927] [ENSMUST00000063071] [ENSMUST00000159286] [ENSMUST00000160191] [ENSMUST00000167294] [ENSMUST00000168196]
Predicted Effect probably null
Transcript: ENSMUST00000014927
AA Change: R990*
SMART Domains Protein: ENSMUSP00000014927
Gene: ENSMUSG00000014782
AA Change: R990*

DomainStartEndE-ValueType
low complexity region 364 377 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
low complexity region 463 475 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
low complexity region 559 577 N/A INTRINSIC
low complexity region 653 664 N/A INTRINSIC
low complexity region 701 718 N/A INTRINSIC
RhoGEF 729 900 3.15e-29 SMART
PH 914 1022 1.44e-5 SMART
low complexity region 1148 1169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063071
SMART Domains Protein: ENSMUSP00000050687
Gene: ENSMUSG00000051648

DomainStartEndE-ValueType
Pfam:BTB_2 15 92 1.3e-9 PFAM
internal_repeat_1 173 251 8.34e-9 PROSPERO
internal_repeat_1 429 509 8.34e-9 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000159286
SMART Domains Protein: ENSMUSP00000125556
Gene: ENSMUSG00000014782

DomainStartEndE-ValueType
SCOP:d1aua_2 136 275 5e-9 SMART
Blast:SEC14 137 271 9e-8 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000160191
AA Change: R921*
SMART Domains Protein: ENSMUSP00000125249
Gene: ENSMUSG00000014782
AA Change: R921*

DomainStartEndE-ValueType
low complexity region 295 308 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 394 406 N/A INTRINSIC
low complexity region 466 478 N/A INTRINSIC
low complexity region 490 508 N/A INTRINSIC
low complexity region 584 595 N/A INTRINSIC
low complexity region 632 649 N/A INTRINSIC
RhoGEF 660 831 3.15e-29 SMART
PH 845 953 1.44e-5 SMART
low complexity region 1079 1100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167294
SMART Domains Protein: ENSMUSP00000130831
Gene: ENSMUSG00000051648

DomainStartEndE-ValueType
Pfam:BTB_2 15 93 3.9e-10 PFAM
internal_repeat_1 173 251 6.24e-9 PROSPERO
internal_repeat_1 406 486 6.24e-9 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000168196
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can function as a guanine nucleotide exchange factor (GEF) and may play a role in intracellular signaling and cytoskeleton dynamics at the Golgi apparatus. Polymorphisms in the region of this gene have been found to be associated with spinocerebellar ataxia in some study populations. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T C 8: 40,825,069 S166P probably damaging Het
Appl1 T A 14: 26,964,957 T19S probably damaging Het
Arid4b T A 13: 14,170,009 D557E probably benign Het
Aven C T 2: 112,559,775 R8W probably benign Het
C2cd2l T C 9: 44,316,205 E307G possibly damaging Het
Cdh7 A C 1: 110,100,102 T526P probably benign Het
Dchs1 C T 7: 105,765,511 V775M probably benign Het
Dennd1b A G 1: 139,041,935 N63S probably benign Het
Dtnb A T 12: 3,644,056 Y248F unknown Het
Ehbp1l1 T A 19: 5,720,061 T405S possibly damaging Het
Fam149a A G 8: 45,350,453 Y415H possibly damaging Het
Fam186a A G 15: 99,941,310 L2351P unknown Het
Fsip2 T G 2: 82,989,343 I5140S possibly damaging Het
Gm8674 T C 13: 49,900,226 T749A noncoding transcript Het
Grasp C T 15: 101,231,021 L217F probably damaging Het
Inadl A G 4: 98,682,071 E1711G possibly damaging Het
Kalrn A G 16: 34,049,783 V1894A noncoding transcript Het
Kpna3 A T 14: 61,387,470 N141K probably damaging Het
Lrba G A 3: 86,542,575 G2067D probably damaging Het
Lrp2 G T 2: 69,481,267 Y2622* probably null Het
Lrtm2 A C 6: 119,320,817 F88V probably damaging Het
Mboat1 T C 13: 30,245,350 S454P probably damaging Het
Nkpd1 C T 7: 19,519,828 P40S probably benign Het
Olfr1065 C A 2: 86,445,129 M284I noncoding transcript Het
Olfr1249 T A 2: 89,630,563 I112F probably damaging Het
Olfr1535 T C 13: 21,555,618 I135V probably benign Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pcdha4 A T 18: 36,953,075 I104F probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pphln1 T C 15: 93,489,049 S343P probably benign Het
Pram1 A T 17: 33,641,267 K269N probably damaging Het
Psmd13 T A 7: 140,886,537 I79K probably damaging Het
Ptprf T C 4: 118,212,112 D1586G possibly damaging Het
Ptprh T A 7: 4,581,091 Q167H probably damaging Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Rreb1 T C 13: 37,893,872 M20T probably damaging Het
Scrn2 T G 11: 97,032,220 L163R probably damaging Het
Slc36a3 C T 11: 55,131,607 V254I probably benign Het
Slc6a6 T C 6: 91,724,970 F120L probably benign Het
Slc8a2 A T 7: 16,145,305 H572L probably benign Het
Spats2 T A 15: 99,208,895 D357E probably damaging Het
Speg A T 1: 75,419,033 N1816I probably damaging Het
Sult2b1 A G 7: 45,783,937 V2A unknown Het
Susd3 T C 13: 49,231,255 T231A probably benign Het
Tcp1 A G 17: 12,920,851 D261G probably benign Het
Trpm2 C G 10: 77,936,002 S601T probably benign Het
Ugt2b38 A T 5: 87,423,800 F124L probably benign Het
Unc80 G T 1: 66,654,019 E2522D probably benign Het
Usp34 A G 11: 23,446,750 T2365A Het
Vmn2r92 G T 17: 18,185,016 M807I probably benign Het
Vps13b C A 15: 35,597,404 P1030Q probably damaging Het
Wrn T G 8: 33,329,185 K246N probably damaging Het
Zer1 T A 2: 30,101,135 probably null Het
Other mutations in Plekhg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Plekhg4 APN 8 105375738 missense probably benign 0.01
IGL00970:Plekhg4 APN 8 105378435 missense probably benign 0.02
IGL01784:Plekhg4 APN 8 105378957 missense probably damaging 1.00
IGL02063:Plekhg4 APN 8 105379252 splice site probably benign
IGL02371:Plekhg4 APN 8 105379059 splice site probably null
IGL02984:Plekhg4 UTSW 8 105380388 missense probably damaging 1.00
R0013:Plekhg4 UTSW 8 105375396 nonsense probably null
R0105:Plekhg4 UTSW 8 105382012 missense possibly damaging 0.65
R0105:Plekhg4 UTSW 8 105382012 missense possibly damaging 0.65
R0631:Plekhg4 UTSW 8 105379302 missense probably damaging 1.00
R1078:Plekhg4 UTSW 8 105381677 nonsense probably null
R1201:Plekhg4 UTSW 8 105381673 missense probably damaging 1.00
R1222:Plekhg4 UTSW 8 105379110 missense probably benign 0.03
R1418:Plekhg4 UTSW 8 105379110 missense probably benign 0.03
R1459:Plekhg4 UTSW 8 105381799 missense probably damaging 0.98
R1465:Plekhg4 UTSW 8 105381040 splice site probably benign
R1558:Plekhg4 UTSW 8 105381835 missense possibly damaging 0.73
R1637:Plekhg4 UTSW 8 105381781 missense probably benign 0.08
R1757:Plekhg4 UTSW 8 105381661 missense probably damaging 0.99
R1922:Plekhg4 UTSW 8 105378385 missense probably damaging 1.00
R1961:Plekhg4 UTSW 8 105381464 missense probably damaging 0.99
R2074:Plekhg4 UTSW 8 105376452 small deletion probably benign
R2113:Plekhg4 UTSW 8 105379434 missense probably damaging 1.00
R2124:Plekhg4 UTSW 8 105376452 small deletion probably benign
R2196:Plekhg4 UTSW 8 105376452 small deletion probably benign
R2321:Plekhg4 UTSW 8 105377540 missense probably benign 0.00
R2432:Plekhg4 UTSW 8 105381836 missense probably benign 0.00
R2908:Plekhg4 UTSW 8 105380861 missense probably damaging 1.00
R2910:Plekhg4 UTSW 8 105376452 small deletion probably benign
R4179:Plekhg4 UTSW 8 105381398 missense possibly damaging 0.93
R4180:Plekhg4 UTSW 8 105381398 missense possibly damaging 0.93
R4513:Plekhg4 UTSW 8 105380402 missense probably damaging 1.00
R4678:Plekhg4 UTSW 8 105380371 nonsense probably null
R4946:Plekhg4 UTSW 8 105381996 missense probably null 0.01
R5223:Plekhg4 UTSW 8 105378949 missense probably benign 0.18
R5362:Plekhg4 UTSW 8 105381398 missense possibly damaging 0.93
R5454:Plekhg4 UTSW 8 105376113 critical splice donor site probably null
R5609:Plekhg4 UTSW 8 105379502 critical splice donor site probably null
R5624:Plekhg4 UTSW 8 105380750 missense probably damaging 0.99
R5806:Plekhg4 UTSW 8 105378910 missense possibly damaging 0.85
R6297:Plekhg4 UTSW 8 105377840 missense probably damaging 1.00
R7198:Plekhg4 UTSW 8 105378697 missense probably damaging 1.00
R7443:Plekhg4 UTSW 8 105380867 missense probably damaging 1.00
R7570:Plekhg4 UTSW 8 105378684 missense possibly damaging 0.95
R7577:Plekhg4 UTSW 8 105375399 missense probably benign
R7632:Plekhg4 UTSW 8 105380150 missense probably damaging 1.00
R7782:Plekhg4 UTSW 8 105377767 missense probably benign 0.14
R7958:Plekhg4 UTSW 8 105376649 missense possibly damaging 0.86
R8335:Plekhg4 UTSW 8 105376216 missense probably damaging 0.97
Z1177:Plekhg4 UTSW 8 105374842 missense unknown
Predicted Primers PCR Primer
(F):5'- TGCAGGGGTTGACATATTCACC -3'
(R):5'- GACAGGATACACTCTAGGAGCC -3'

Sequencing Primer
(F):5'- GGGGTTGACATATTCACCTACAAGC -3'
(R):5'- GGATACACTCTAGGAGCCTCACTTC -3'
Posted On2020-07-13