Incidental Mutation 'R8239:Trpm2'
ID637512
Institutional Source Beutler Lab
Gene Symbol Trpm2
Ensembl Gene ENSMUSG00000009292
Gene Nametransient receptor potential cation channel, subfamily M, member 2
SynonymsLTRPC2, 9830168K16Rik, TRPC7, Trrp7
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R8239 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location77907722-77970563 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 77936002 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 601 (S601T)
Ref Sequence ENSEMBL: ENSMUSP00000101040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105401]
Predicted Effect probably benign
Transcript: ENSMUST00000105401
AA Change: S601T

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000101040
Gene: ENSMUSG00000009292
AA Change: S601T

DomainStartEndE-ValueType
low complexity region 654 672 N/A INTRINSIC
transmembrane domain 750 772 N/A INTRINSIC
Pfam:Ion_trans 794 1057 3.7e-21 PFAM
low complexity region 1078 1090 N/A INTRINSIC
low complexity region 1106 1115 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
PDB:1QVJ|A 1236 1506 3e-37 PDB
SCOP:d1k2ea_ 1369 1502 9e-10 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a tetrameric cation channel that is permeable to calcium, sodium, and potassium and is regulated by free intracellular ADP-ribose. The encoded protein is activated by oxidative stress and confers susceptibility to cell death. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. Additional transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired reactive oxygen species (ROS)-induced chemokine production in monocytes, and reduced neutrophil infiltration and ulceration in a dextran sulfate sodium-induced colitis inflammation model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T C 8: 40,825,069 S166P probably damaging Het
Appl1 T A 14: 26,964,957 T19S probably damaging Het
Arid4b T A 13: 14,170,009 D557E probably benign Het
Aven C T 2: 112,559,775 R8W probably benign Het
C2cd2l T C 9: 44,316,205 E307G possibly damaging Het
Cdh7 A C 1: 110,100,102 T526P probably benign Het
Dchs1 C T 7: 105,765,511 V775M probably benign Het
Dennd1b A G 1: 139,041,935 N63S probably benign Het
Dtnb A T 12: 3,644,056 Y248F unknown Het
Ehbp1l1 T A 19: 5,720,061 T405S possibly damaging Het
Fam149a A G 8: 45,350,453 Y415H possibly damaging Het
Fam186a A G 15: 99,941,310 L2351P unknown Het
Fsip2 T G 2: 82,989,343 I5140S possibly damaging Het
Gm8674 T C 13: 49,900,226 T749A noncoding transcript Het
Grasp C T 15: 101,231,021 L217F probably damaging Het
Inadl A G 4: 98,682,071 E1711G possibly damaging Het
Kalrn A G 16: 34,049,783 V1894A noncoding transcript Het
Kpna3 A T 14: 61,387,470 N141K probably damaging Het
Lrba G A 3: 86,542,575 G2067D probably damaging Het
Lrp2 G T 2: 69,481,267 Y2622* probably null Het
Lrtm2 A C 6: 119,320,817 F88V probably damaging Het
Mboat1 T C 13: 30,245,350 S454P probably damaging Het
Nkpd1 C T 7: 19,519,828 P40S probably benign Het
Olfr1065 C A 2: 86,445,129 M284I noncoding transcript Het
Olfr1249 T A 2: 89,630,563 I112F probably damaging Het
Olfr1535 T C 13: 21,555,618 I135V probably benign Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pcdha4 A T 18: 36,953,075 I104F probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Plekhg4 C T 8: 105,380,914 R990* probably null Het
Pphln1 T C 15: 93,489,049 S343P probably benign Het
Pram1 A T 17: 33,641,267 K269N probably damaging Het
Psmd13 T A 7: 140,886,537 I79K probably damaging Het
Ptprf T C 4: 118,212,112 D1586G possibly damaging Het
Ptprh T A 7: 4,581,091 Q167H probably damaging Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Rreb1 T C 13: 37,893,872 M20T probably damaging Het
Scrn2 T G 11: 97,032,220 L163R probably damaging Het
Slc36a3 C T 11: 55,131,607 V254I probably benign Het
Slc6a6 T C 6: 91,724,970 F120L probably benign Het
Slc8a2 A T 7: 16,145,305 H572L probably benign Het
Spats2 T A 15: 99,208,895 D357E probably damaging Het
Speg A T 1: 75,419,033 N1816I probably damaging Het
Sult2b1 A G 7: 45,783,937 V2A unknown Het
Susd3 T C 13: 49,231,255 T231A probably benign Het
Tcp1 A G 17: 12,920,851 D261G probably benign Het
Ugt2b38 A T 5: 87,423,800 F124L probably benign Het
Unc80 G T 1: 66,654,019 E2522D probably benign Het
Usp34 A G 11: 23,446,750 T2365A Het
Vmn2r92 G T 17: 18,185,016 M807I probably benign Het
Vps13b C A 15: 35,597,404 P1030Q probably damaging Het
Wrn T G 8: 33,329,185 K246N probably damaging Het
Zer1 T A 2: 30,101,135 probably null Het
Other mutations in Trpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Trpm2 APN 10 77942915 splice site probably null
IGL00773:Trpm2 APN 10 77949214 nonsense probably null
IGL00962:Trpm2 APN 10 77943916 splice site probably benign
IGL01093:Trpm2 APN 10 77932280 missense probably benign 0.04
IGL01124:Trpm2 APN 10 77945825 splice site probably benign
IGL01301:Trpm2 APN 10 77923984 missense probably damaging 1.00
IGL02094:Trpm2 APN 10 77942996 nonsense probably null
IGL02175:Trpm2 APN 10 77937907 missense probably benign 0.07
IGL02653:Trpm2 APN 10 77912669 missense probably benign 0.19
IGL02667:Trpm2 APN 10 77935942 missense probably damaging 1.00
IGL02668:Trpm2 APN 10 77935942 missense probably damaging 1.00
IGL02828:Trpm2 APN 10 77918986 missense probably benign 0.16
IGL02951:Trpm2 APN 10 77929278 missense possibly damaging 0.95
IGL03188:Trpm2 APN 10 77918909 missense probably benign 0.18
IGL03242:Trpm2 APN 10 77917734 missense probably benign
IGL03405:Trpm2 APN 10 77966072 splice site probably benign
Fugit UTSW 10 77938368 missense probably damaging 1.00
scusate UTSW 10 77966994 nonsense probably null
temporal UTSW 10 77925682 missense probably benign 0.30
ANU18:Trpm2 UTSW 10 77923984 missense probably damaging 1.00
R0147:Trpm2 UTSW 10 77925825 missense probably damaging 1.00
R0148:Trpm2 UTSW 10 77925825 missense probably damaging 1.00
R0302:Trpm2 UTSW 10 77943990 splice site probably benign
R0332:Trpm2 UTSW 10 77947988 missense probably damaging 1.00
R0586:Trpm2 UTSW 10 77923516 missense probably damaging 0.99
R0847:Trpm2 UTSW 10 77929288 missense possibly damaging 0.94
R1183:Trpm2 UTSW 10 77923564 missense probably damaging 1.00
R1472:Trpm2 UTSW 10 77966007 missense probably damaging 1.00
R1510:Trpm2 UTSW 10 77966994 nonsense probably null
R1518:Trpm2 UTSW 10 77943005 missense possibly damaging 0.67
R1564:Trpm2 UTSW 10 77942999 missense probably benign 0.14
R1593:Trpm2 UTSW 10 77943076 missense possibly damaging 0.71
R1617:Trpm2 UTSW 10 77935875 splice site probably null
R1673:Trpm2 UTSW 10 77942944 missense probably benign
R1912:Trpm2 UTSW 10 77945876 missense probably benign 0.10
R1932:Trpm2 UTSW 10 77941158 missense probably damaging 1.00
R1993:Trpm2 UTSW 10 77947989 missense probably damaging 1.00
R2013:Trpm2 UTSW 10 77925766 missense probably damaging 1.00
R2151:Trpm2 UTSW 10 77932179 missense probably benign 0.01
R2201:Trpm2 UTSW 10 77920471 nonsense probably null
R2217:Trpm2 UTSW 10 77941182 missense probably damaging 1.00
R2312:Trpm2 UTSW 10 77918964 missense probably benign 0.04
R2339:Trpm2 UTSW 10 77914806 splice site probably benign
R2395:Trpm2 UTSW 10 77947880 missense possibly damaging 0.69
R2396:Trpm2 UTSW 10 77930637 missense probably benign 0.14
R2405:Trpm2 UTSW 10 77934724 missense probably damaging 1.00
R2567:Trpm2 UTSW 10 77941174 missense probably damaging 0.99
R3001:Trpm2 UTSW 10 77930534 critical splice donor site probably null
R3002:Trpm2 UTSW 10 77930534 critical splice donor site probably null
R3125:Trpm2 UTSW 10 77911374 missense probably damaging 1.00
R3500:Trpm2 UTSW 10 77932302 missense probably benign 0.03
R3777:Trpm2 UTSW 10 77935990 missense probably benign 0.13
R3778:Trpm2 UTSW 10 77935990 missense probably benign 0.13
R4272:Trpm2 UTSW 10 77933642 missense probably damaging 1.00
R4384:Trpm2 UTSW 10 77917725 missense probably benign 0.44
R4395:Trpm2 UTSW 10 77929219 missense probably benign 0.01
R4423:Trpm2 UTSW 10 77935068 missense probably benign 0.00
R4452:Trpm2 UTSW 10 77923593 missense probably damaging 1.00
R4612:Trpm2 UTSW 10 77945916 missense probably damaging 0.99
R4662:Trpm2 UTSW 10 77938138 missense probably benign 0.05
R4825:Trpm2 UTSW 10 77941173 missense probably damaging 0.98
R4906:Trpm2 UTSW 10 77932189 nonsense probably null
R4943:Trpm2 UTSW 10 77966007 missense probably damaging 1.00
R4948:Trpm2 UTSW 10 77917792 missense probably benign 0.34
R5046:Trpm2 UTSW 10 77966018 missense probably damaging 1.00
R5320:Trpm2 UTSW 10 77923521 missense probably benign 0.06
R5523:Trpm2 UTSW 10 77935961 missense probably benign 0.04
R5562:Trpm2 UTSW 10 77959939 missense possibly damaging 0.71
R5623:Trpm2 UTSW 10 77932139 missense probably damaging 0.96
R5628:Trpm2 UTSW 10 77912636 missense probably benign 0.00
R5633:Trpm2 UTSW 10 77938353 missense possibly damaging 0.71
R5817:Trpm2 UTSW 10 77965980 missense probably damaging 1.00
R5989:Trpm2 UTSW 10 77959900 missense probably damaging 1.00
R6018:Trpm2 UTSW 10 77917713 missense probably benign 0.00
R6075:Trpm2 UTSW 10 77935043 critical splice donor site probably null
R6092:Trpm2 UTSW 10 77925682 missense probably benign 0.30
R6309:Trpm2 UTSW 10 77938368 missense probably damaging 1.00
R6327:Trpm2 UTSW 10 77932227 missense probably damaging 1.00
R6568:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6579:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6640:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6642:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6798:Trpm2 UTSW 10 77914740 missense probably damaging 0.99
R6999:Trpm2 UTSW 10 77935891 missense probably damaging 1.00
R7034:Trpm2 UTSW 10 77912592 missense probably benign
R7036:Trpm2 UTSW 10 77912592 missense probably benign
R7113:Trpm2 UTSW 10 77947931 missense probably damaging 0.96
R7171:Trpm2 UTSW 10 77924014 missense probably damaging 1.00
R7240:Trpm2 UTSW 10 77935876 critical splice donor site probably null
R7274:Trpm2 UTSW 10 77923555 missense probably benign 0.00
R7379:Trpm2 UTSW 10 77914734 missense probably benign
R7527:Trpm2 UTSW 10 77966060 missense probably benign 0.01
R7571:Trpm2 UTSW 10 77937950 missense probably benign 0.21
R7600:Trpm2 UTSW 10 77938051 missense probably benign 0.02
R7727:Trpm2 UTSW 10 77925789 missense probably benign 0.34
R7771:Trpm2 UTSW 10 77932179 missense probably benign 0.01
R7844:Trpm2 UTSW 10 77923506 missense probably benign 0.00
R8158:Trpm2 UTSW 10 77947897 missense probably damaging 0.99
R8225:Trpm2 UTSW 10 77947973 missense probably damaging 1.00
R8226:Trpm2 UTSW 10 77947973 missense probably damaging 1.00
R8275:Trpm2 UTSW 10 77966025 nonsense probably null
R8340:Trpm2 UTSW 10 77923624 nonsense probably null
Z1177:Trpm2 UTSW 10 77937868 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TTTGCTGCAGGAAGTGAGTCC -3'
(R):5'- GTGTGTTGTACATACATTTGGACC -3'

Sequencing Primer
(F):5'- TGCAGGAAGTGAGTCCCTGAC -3'
(R):5'- GGGGATCTCGATCAACTGTTACTAC -3'
Posted On2020-07-13