Mutagenetix > Incidental Mutation

Incidental Mutation 'R0726:Lepr'

63752

Institutional Source

Beutler Lab

Gene Symbol

Lepr

Ensembl Gene

ENSMUSG00000057722

Gene Name

leptin receptor

Synonyms

obl, Leprb, Obr, obese-like, OB-RGRP, Modb1, leptin receptor gene-related protein, LEPROT

MMRRC Submission

038908-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0726 (G1)

Quality Score

170

Status

Validated

Chromosome

Chromosomal Location

101717404-101815352 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 101764934 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 354 (N354K)

Ref Sequence

ENSEMBL: ENSMUSP00000102534 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037552] [ENSMUST00000102777] [ENSMUST00000106921]

AlphaFold

P48356

Predicted Effect

probably benign
Transcript: ENSMUST00000037552
AA Change: N354K

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000037385
Gene: ENSMUSG00000057722
AA Change: N354K

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
FN3	236	315	1.5e-5	SMART
Pfam:Lep_receptor_Ig	328	418	6.3e-23	PFAM
FN3	535	618	4.93e-1	SMART
FN3	641	721	3.25e1	SMART
FN3	736	818	2.35e0	SMART
transmembrane domain	838	860	N/A	INTRINSIC
low complexity region	908	921	N/A	INTRINSIC
low complexity region	1050	1065	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102777
AA Change: N354K

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000099838
Gene: ENSMUSG00000057722
AA Change: N354K

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
FN3	236	315	1.5e-5	SMART
Pfam:Lep_receptor_Ig	329	420	2.6e-29	PFAM
FN3	535	618	4.93e-1	SMART
FN3	641	721	3.25e1	SMART
FN3	736	818	2.35e0	SMART
transmembrane domain	838	860	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106921
AA Change: N354K

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000102534
Gene: ENSMUSG00000057722
AA Change: N354K

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
FN3	236	315	1.5e-5	SMART
Pfam:Lep_receptor_Ig	329	420	2.6e-29	PFAM
FN3	535	618	4.93e-1	SMART
FN3	641	721	3.25e1	SMART
FN3	736	818	2.35e0	SMART
transmembrane domain	838	860	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128948

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.1%
20x: 89.2%

Validation Efficiency

98% (90/92)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT proteins. This protein is a receptor for leptin (an adipocyte-specific hormone that regulates body weight), and is involved in the regulation of fat metabolism, as well as in a novel hematopoietic pathway that is required for normal lymphopoiesis. Mutations in this gene have been associated with obesity and pituitary dysfunction. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. It is noteworthy that this gene and LEPROT gene (GeneID:54741) share the same promoter and the first 2 exons, however, encode distinct proteins (PMID:9207021).[provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous mutants are hyperphagic, low-activity, poorly cold-adapted, sterile and have enhanced fat conversion. They are obese, hyperinsulinemic and, on certain strains, severely hyperglycemic. Heterozygotes are normal but resistant to prolonged fasting. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alg12	T	C	15: 88,806,647	Y256C	probably damaging	Het
Alox15	T	A	11: 70,350,195	D160V	probably damaging	Het
Aox2	T	C	1: 58,334,782		probably benign	Het
Bbs9	G	T	9: 22,793,823	A729S	probably damaging	Het
Bmp2k	T	A	5: 97,087,494		probably benign	Het
Braf	C	T	6: 39,662,148	R223Q	possibly damaging	Het
Cd101	A	T	3: 101,020,622	S48T	possibly damaging	Het
Cdh9	T	G	15: 16,831,044	D322E	probably benign	Het
Col28a1	C	T	6: 8,014,495		probably null	Het
Cpxm1	G	A	2: 130,390,939	R712W	probably damaging	Het
Csnk1g1	T	C	9: 66,032,355		probably benign	Het
Cyp2d37-ps	A	C	15: 82,690,449		noncoding transcript	Het
Cyth3	T	C	5: 143,692,642	V115A	probably benign	Het
Dnah9	C	T	11: 65,965,681	V2885M	probably damaging	Het
Dock9	G	T	14: 121,651,768	Y326*	probably null	Het
Espl1	T	C	15: 102,322,598	I1844T	probably benign	Het
Fam105a	A	T	15: 27,656,947	I338N	probably damaging	Het
Fam20a	T	A	11: 109,677,194	N357Y	probably damaging	Het
Fancc	C	A	13: 63,323,411	R385L	probably benign	Het
Foxe3	A	T	4: 114,925,250	L255H	unknown	Het
Frem2	T	C	3: 53,519,626	D2967G	possibly damaging	Het
Gabra6	T	G	11: 42,315,127	T301P	probably damaging	Het
Ganab	T	A	19: 8,911,113	Y511N	probably damaging	Het
Gm498	A	G	7: 143,871,761	D49G	probably damaging	Het
Grm4	T	A	17: 27,438,438		probably benign	Het
Hist1h1t	G	T	13: 23,696,324	K153N	possibly damaging	Het
Kcnj9	G	A	1: 172,325,921	S212F	probably damaging	Het
Kif15	C	A	9: 122,959,928	H62N	probably benign	Het
Kptn	A	G	7: 16,120,722	D106G	probably damaging	Het
Krtap13-1	T	A	16: 88,729,304	S139T	probably damaging	Het
Lypd3	G	T	7: 24,638,544	E112*	probably null	Het
Med13l	A	T	5: 118,748,684	N1550I	probably damaging	Het
Mettl2	C	T	11: 105,126,844	P60L	probably benign	Het
Muc4	A	G	16: 32,769,827	E850G	probably damaging	Het
Mylk	G	C	16: 34,879,475	E403Q	possibly damaging	Het
Nek1	A	G	8: 61,089,592	R739G	probably damaging	Het
Nipbl	A	T	15: 8,351,555	D584E	probably benign	Het
Nkain3	C	T	4: 20,158,388	V162M	possibly damaging	Het
Nmrk1	T	C	19: 18,641,480		probably benign	Het
Nsd2	T	C	5: 33,861,028		probably benign	Het
Olfr1198	A	T	2: 88,746,008	N293K	probably benign	Het
Olfr1270	T	A	2: 90,149,283	H241L	probably damaging	Het
Olfr133	T	C	17: 38,148,624	F12S	probably damaging	Het
Olfr1449	T	A	19: 12,935,605	V289D	probably damaging	Het
Olfr907	T	A	9: 38,499,122	M151K	possibly damaging	Het
Phex	T	A	X: 157,372,561		probably benign	Het
Pip5k1b	G	T	19: 24,378,892	D227E	probably damaging	Het
Prdm13	A	G	4: 21,683,914	I119T	unknown	Het
Rab19	G	T	6: 39,383,959	V14L	probably benign	Het
Rasa3	A	G	8: 13,580,118		probably benign	Het
Rgsl1	C	T	1: 153,802,328	S118N	probably damaging	Het
Rif1	C	T	2: 52,110,353	T1273M	possibly damaging	Het
Scn8a	A	G	15: 100,972,830	N254S	probably damaging	Het
Sema6a	T	C	18: 47,291,981	T188A	probably damaging	Het
Sh3pxd2a	C	T	19: 47,268,762	E506K	probably damaging	Het
Smarca2	A	T	19: 26,698,403	K1014N	probably damaging	Het
Smarca4	T	G	9: 21,700,139		probably null	Het
Sntb1	T	C	15: 55,676,356	R361G	probably benign	Het
Soga1	G	T	2: 157,060,262	R278S	probably damaging	Het
Stx5a	T	A	19: 8,754,911	I208N	probably damaging	Het
Tas2r102	T	A	6: 132,762,452	W108R	probably damaging	Het
Tcl1	A	G	12: 105,218,670	Y94H	probably damaging	Het
Tenm3	T	A	8: 48,236,594	Y1986F	probably damaging	Het
Tet2	G	A	3: 133,468,184	P1439L	probably benign	Het
Tiam2	T	C	17: 3,512,833		probably benign	Het
Ubap2l	G	A	3: 90,021,246	T526M	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Uhrf1bp1	T	C	17: 27,885,489	V503A	possibly damaging	Het
Ushbp1	T	A	8: 71,388,747		probably benign	Het
Usp28	C	T	9: 49,003,869	R115C	probably damaging	Het
Vldlr	A	T	19: 27,238,386	D261V	probably damaging	Het
Vmn2r5	C	T	3: 64,503,765	D461N	probably benign	Het
Vmn2r86	A	T	10: 130,446,396	F784I	probably damaging	Het
Zfp59	A	T	7: 27,854,088	I322F	probably damaging	Het
Zfp607a	A	T	7: 27,879,149	H548L	probably benign	Het
Zfp626	G	A	7: 27,818,623	C343Y	probably damaging	Het

Other mutations in Lepr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Lepr	APN	4	101815035	missense	probably benign
IGL01111:Lepr	APN	4	101814655	missense	possibly damaging	0.77
IGL01324:Lepr	APN	4	101768068	missense	probably benign	0.23
IGL01372:Lepr	APN	4	101735577	missense	possibly damaging	0.67
IGL01626:Lepr	APN	4	101733534	missense	probably benign	0.10
IGL01733:Lepr	APN	4	101765082	missense	probably benign	0.00
IGL01815:Lepr	APN	4	101814790	missense	possibly damaging	0.49
IGL01899:Lepr	APN	4	101779987	missense	possibly damaging	0.86
IGL02138:Lepr	APN	4	101768067	missense	probably damaging	0.98
IGL02161:Lepr	APN	4	101745678	missense	probably damaging	0.97
IGL02653:Lepr	APN	4	101764944	missense	probably benign	0.44
IGL02735:Lepr	APN	4	101782638	missense	probably damaging	1.00
IGL03035:Lepr	APN	4	101764980	missense	probably damaging	1.00
IGL03083:Lepr	APN	4	101814679	nonsense	probably null
IGL03160:Lepr	APN	4	101764906	missense	probably damaging	1.00
aufsetzigen	UTSW	4	101752175	missense	probably damaging	1.00
beastly	UTSW	4	101814591	missense	probably benign
business_class	UTSW	4	101764872	missense	probably damaging	1.00
cherub	UTSW	4	101768062	missense	probably benign	0.25
clodhopper	UTSW	4	101765290	splice site	probably null
donner	UTSW	4	101815201	missense	probably damaging	1.00
fluffy	UTSW	4	101792023	missense	probably damaging	1.00
giant	UTSW	4	101765152	critical splice donor site	probably null
gordo	UTSW	4	101765305	missense	probably damaging	0.97
Immunoglutton	UTSW	4	101765301	splice site	probably benign
Jumbo_shrimp	UTSW	4	101764954	nonsense	probably null
lowleaning	UTSW	4	101814391	splice site	probably null
odd	UTSW	4	101728074	splice site	probably benign
paleo	UTSW	4	101745645	missense	possibly damaging	0.94
R0140_Lepr_245	UTSW	4	101768067	missense	probably damaging	1.00
well-upholstered	UTSW	4	101772958	synonymous	probably benign
worldly	UTSW	4	101768228	missense	possibly damaging	0.96
PIT4651001:Lepr	UTSW	4	101791997	missense	probably damaging	1.00
PIT4696001:Lepr	UTSW	4	101779983	missense	probably benign	0.10
R0140:Lepr	UTSW	4	101768067	missense	probably damaging	1.00
R0197:Lepr	UTSW	4	101752152	missense	possibly damaging	0.64
R0279:Lepr	UTSW	4	101750344	missense	probably benign	0.05
R0487:Lepr	UTSW	4	101768093	nonsense	probably null
R0498:Lepr	UTSW	4	101745692	missense	probably benign	0.01
R0506:Lepr	UTSW	4	101773010	splice site	probably benign
R0512:Lepr	UTSW	4	101792019	missense	probably damaging	1.00
R0512:Lepr	UTSW	4	101814704	missense	possibly damaging	0.87
R1054:Lepr	UTSW	4	101782596	missense	probably damaging	0.97
R1109:Lepr	UTSW	4	101771355	missense	probably damaging	1.00
R1398:Lepr	UTSW	4	101792019	missense	probably damaging	1.00
R1464:Lepr	UTSW	4	101735681	missense	probably benign	0.08
R1464:Lepr	UTSW	4	101735681	missense	probably benign	0.08
R1519:Lepr	UTSW	4	101789344	missense	probably damaging	0.97
R1602:Lepr	UTSW	4	101745645	missense	possibly damaging	0.94
R1830:Lepr	UTSW	4	101735677	missense	probably damaging	1.00
R1850:Lepr	UTSW	4	101733423	missense	possibly damaging	0.67
R1918:Lepr	UTSW	4	101772836	missense	probably benign	0.08
R1928:Lepr	UTSW	4	101782730	splice site	probably benign
R2099:Lepr	UTSW	4	101772988	missense	probably damaging	1.00
R2102:Lepr	UTSW	4	101772981	missense	possibly damaging	0.95
R2175:Lepr	UTSW	4	101765379	missense	probably benign	0.01
R2254:Lepr	UTSW	4	101815112	missense	probably benign	0.26
R2396:Lepr	UTSW	4	101733528	missense	probably benign	0.19
R2508:Lepr	UTSW	4	101790896	missense	probably damaging	0.98
R2571:Lepr	UTSW	4	101768172	missense	possibly damaging	0.96
R3790:Lepr	UTSW	4	101790914	splice site	probably benign
R3882:Lepr	UTSW	4	101815265	missense	probably damaging	1.00
R3933:Lepr	UTSW	4	101765301	splice site	probably benign
R4211:Lepr	UTSW	4	101733414	missense	probably benign	0.19
R4343:Lepr	UTSW	4	101765152	critical splice donor site	probably null
R4345:Lepr	UTSW	4	101765152	critical splice donor site	probably null
R4544:Lepr	UTSW	4	101768228	missense	possibly damaging	0.96
R4546:Lepr	UTSW	4	101814641	missense	probably benign	0.35
R4724:Lepr	UTSW	4	101765365	nonsense	probably null
R4797:Lepr	UTSW	4	101780047	missense	possibly damaging	0.90
R4860:Lepr	UTSW	4	101789337	missense	probably benign	0.14
R4860:Lepr	UTSW	4	101789337	missense	probably benign	0.14
R4929:Lepr	UTSW	4	101815117	missense	probably benign	0.00
R4939:Lepr	UTSW	4	101733438	missense	possibly damaging	0.78
R5377:Lepr	UTSW	4	101815019	missense	possibly damaging	0.71
R5520:Lepr	UTSW	4	101745537	missense	probably benign	0.00
R5966:Lepr	UTSW	4	101792127	intron	probably benign
R6092:Lepr	UTSW	4	101792023	missense	probably damaging	1.00
R6130:Lepr	UTSW	4	101765372	missense	probably damaging	0.99
R6168:Lepr	UTSW	4	101735592	missense	probably damaging	0.99
R6232:Lepr	UTSW	4	101814391	splice site	probably null
R6380:Lepr	UTSW	4	101764954	nonsense	probably null
R6427:Lepr	UTSW	4	101774257	missense	possibly damaging	0.47
R6428:Lepr	UTSW	4	101780098	missense	probably damaging	1.00
R6641:Lepr	UTSW	4	101765305	missense	probably damaging	0.97
R6650:Lepr	UTSW	4	101815201	missense	probably damaging	1.00
R6859:Lepr	UTSW	4	101765290	splice site	probably null
R7023:Lepr	UTSW	4	101789287	missense	probably damaging	1.00
R7145:Lepr	UTSW	4	101752197	missense	probably benign	0.00
R7174:Lepr	UTSW	4	101750338	missense	probably benign	0.01
R7179:Lepr	UTSW	4	101745659	missense	probably benign	0.06
R7189:Lepr	UTSW	4	101814764	missense	probably benign	0.00
R7426:Lepr	UTSW	4	101745656	missense	probably benign	0.03
R7531:Lepr	UTSW	4	101752175	missense	probably damaging	1.00
R7620:Lepr	UTSW	4	101752073	missense	probably benign	0.41
R7804:Lepr	UTSW	4	101782586	missense	probably damaging	1.00
R8022:Lepr	UTSW	4	101782557	missense	probably benign	0.32
R8142:Lepr	UTSW	4	101765419	missense	possibly damaging	0.93
R8227:Lepr	UTSW	4	101771362	missense	probably damaging	0.99
R8426:Lepr	UTSW	4	101814644	missense	probably benign	0.12
R8447:Lepr	UTSW	4	101814491	missense	probably benign	0.08
R8531:Lepr	UTSW	4	101765415	missense	probably damaging	1.00
R8682:Lepr	UTSW	4	101792072	missense	probably benign	0.00
R8897:Lepr	UTSW	4	101792036	missense	probably damaging	0.98
R9096:Lepr	UTSW	4	101774221	missense	possibly damaging	0.95
R9177:Lepr	UTSW	4	101745601	nonsense	probably null
R9241:Lepr	UTSW	4	101814591	missense	probably benign
R9604:Lepr	UTSW	4	101733276	missense	probably benign	0.01
R9711:Lepr	UTSW	4	101735654	nonsense	probably null
X0026:Lepr	UTSW	4	101733327	missense	possibly damaging	0.47
Z1176:Lepr	UTSW	4	101745614	missense	probably damaging	0.99
Z1177:Lepr	UTSW	4	101735595	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAGCAGCAGCAAGGTTCTCAG -3'
(R):5'- TTCAGCATAGCGGTGATGGCAC -3'

Sequencing Primer
(F):5'- CACGCATTTGATTTTGGCAG -3'
(R):5'- GCACGCCTGCTCATTGC -3'

Posted On

2013-07-30