Incidental Mutation 'R8239:Rreb1'
ID 637520
Institutional Source Beutler Lab
Gene Symbol Rreb1
Ensembl Gene ENSMUSG00000039087
Gene Name ras responsive element binding protein 1
Synonyms 1110037N09Rik, B930013M22Rik
MMRRC Submission 067646-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.952) question?
Stock # R8239 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 37962376-38135981 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 38077848 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 20 (M20T)
Ref Sequence ENSEMBL: ENSMUSP00000105867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037232] [ENSMUST00000110237] [ENSMUST00000110238] [ENSMUST00000122842] [ENSMUST00000124373] [ENSMUST00000128570] [ENSMUST00000138043] [ENSMUST00000138110] [ENSMUST00000149745]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000037232
AA Change: M20T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000049265
Gene: ENSMUSG00000039087
AA Change: M20T

DomainStartEndE-ValueType
ZnF_C2H2 66 88 5.14e-3 SMART
ZnF_C2H2 97 119 6.42e-4 SMART
ZnF_C2H2 125 147 3.49e-5 SMART
low complexity region 156 175 N/A INTRINSIC
ZnF_C2H2 206 228 1.01e-1 SMART
ZnF_C2H2 233 256 3.78e-1 SMART
ZnF_C2H2 314 336 2.05e-2 SMART
ZnF_C2H2 641 663 2.71e-2 SMART
ZnF_C2H2 669 691 2.27e-4 SMART
ZnF_C2H2 697 720 5.81e-2 SMART
ZnF_C2H2 751 773 9.44e-2 SMART
ZnF_C2H2 788 811 2.14e0 SMART
low complexity region 916 927 N/A INTRINSIC
low complexity region 968 977 N/A INTRINSIC
low complexity region 995 1003 N/A INTRINSIC
low complexity region 1032 1062 N/A INTRINSIC
low complexity region 1071 1083 N/A INTRINSIC
low complexity region 1119 1146 N/A INTRINSIC
low complexity region 1154 1171 N/A INTRINSIC
ZnF_C2H2 1251 1273 1.5e-4 SMART
ZnF_C2H2 1279 1302 1.01e-1 SMART
low complexity region 1324 1339 N/A INTRINSIC
low complexity region 1370 1403 N/A INTRINSIC
ZnF_C2H2 1454 1476 6.13e-1 SMART
low complexity region 1501 1516 N/A INTRINSIC
low complexity region 1535 1548 N/A INTRINSIC
ZnF_C2H2 1574 1596 2.24e-3 SMART
ZnF_C2H2 1602 1624 4.47e-3 SMART
low complexity region 1636 1651 N/A INTRINSIC
low complexity region 1692 1714 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110237
AA Change: M20T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105866
Gene: ENSMUSG00000039087
AA Change: M20T

DomainStartEndE-ValueType
ZnF_C2H2 66 88 5.14e-3 SMART
ZnF_C2H2 97 119 6.42e-4 SMART
ZnF_C2H2 125 147 3.49e-5 SMART
low complexity region 156 175 N/A INTRINSIC
ZnF_C2H2 206 228 1.01e-1 SMART
ZnF_C2H2 233 256 3.78e-1 SMART
ZnF_C2H2 314 336 2.05e-2 SMART
ZnF_C2H2 641 663 2.71e-2 SMART
ZnF_C2H2 669 691 2.27e-4 SMART
ZnF_C2H2 697 720 5.81e-2 SMART
ZnF_C2H2 751 773 9.44e-2 SMART
ZnF_C2H2 788 811 2.14e0 SMART
low complexity region 916 927 N/A INTRINSIC
low complexity region 968 977 N/A INTRINSIC
low complexity region 995 1003 N/A INTRINSIC
low complexity region 1032 1062 N/A INTRINSIC
low complexity region 1071 1083 N/A INTRINSIC
low complexity region 1119 1146 N/A INTRINSIC
low complexity region 1154 1171 N/A INTRINSIC
ZnF_C2H2 1251 1273 1.5e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110238
AA Change: M20T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105867
Gene: ENSMUSG00000039087
AA Change: M20T

DomainStartEndE-ValueType
ZnF_C2H2 66 88 5.14e-3 SMART
ZnF_C2H2 97 119 6.42e-4 SMART
ZnF_C2H2 125 147 3.49e-5 SMART
low complexity region 156 175 N/A INTRINSIC
ZnF_C2H2 206 228 1.01e-1 SMART
ZnF_C2H2 233 256 3.78e-1 SMART
ZnF_C2H2 314 336 2.05e-2 SMART
ZnF_C2H2 641 663 2.71e-2 SMART
ZnF_C2H2 669 691 2.27e-4 SMART
ZnF_C2H2 697 720 5.81e-2 SMART
ZnF_C2H2 751 773 9.44e-2 SMART
ZnF_C2H2 788 811 2.14e0 SMART
low complexity region 916 927 N/A INTRINSIC
low complexity region 968 977 N/A INTRINSIC
low complexity region 995 1003 N/A INTRINSIC
low complexity region 1032 1062 N/A INTRINSIC
low complexity region 1071 1083 N/A INTRINSIC
low complexity region 1119 1146 N/A INTRINSIC
low complexity region 1154 1171 N/A INTRINSIC
ZnF_C2H2 1251 1273 1.5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122842
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124268
AA Change: M20T
Predicted Effect probably damaging
Transcript: ENSMUST00000124373
AA Change: M20T

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000128570
AA Change: M20T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115599
Gene: ENSMUSG00000039087
AA Change: M20T

DomainStartEndE-ValueType
ZnF_C2H2 66 88 5.14e-3 SMART
ZnF_C2H2 97 119 6.42e-4 SMART
ZnF_C2H2 125 147 3.49e-5 SMART
low complexity region 156 175 N/A INTRINSIC
ZnF_C2H2 206 228 1.01e-1 SMART
ZnF_C2H2 233 256 3.78e-1 SMART
ZnF_C2H2 314 336 2.05e-2 SMART
ZnF_C2H2 641 663 2.71e-2 SMART
ZnF_C2H2 669 691 2.27e-4 SMART
ZnF_C2H2 697 720 5.81e-2 SMART
ZnF_C2H2 751 773 9.44e-2 SMART
ZnF_C2H2 788 811 2.14e0 SMART
low complexity region 916 927 N/A INTRINSIC
low complexity region 968 977 N/A INTRINSIC
low complexity region 995 1003 N/A INTRINSIC
low complexity region 1032 1062 N/A INTRINSIC
low complexity region 1071 1083 N/A INTRINSIC
low complexity region 1119 1146 N/A INTRINSIC
low complexity region 1154 1171 N/A INTRINSIC
ZnF_C2H2 1251 1273 1.5e-4 SMART
ZnF_C2H2 1279 1302 1.01e-1 SMART
low complexity region 1324 1339 N/A INTRINSIC
low complexity region 1370 1403 N/A INTRINSIC
ZnF_C2H2 1454 1476 6.13e-1 SMART
low complexity region 1501 1516 N/A INTRINSIC
low complexity region 1535 1548 N/A INTRINSIC
ZnF_C2H2 1574 1596 2.24e-3 SMART
ZnF_C2H2 1602 1624 4.47e-3 SMART
low complexity region 1636 1651 N/A INTRINSIC
low complexity region 1692 1714 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138043
Predicted Effect probably damaging
Transcript: ENSMUST00000138110
AA Change: M20T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000149745
AA Change: M20T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000121211
Gene: ENSMUSG00000039087
AA Change: M20T

DomainStartEndE-ValueType
ZnF_C2H2 66 88 5.14e-3 SMART
ZnF_C2H2 97 119 6.42e-4 SMART
ZnF_C2H2 125 147 3.49e-5 SMART
low complexity region 156 175 N/A INTRINSIC
ZnF_C2H2 206 228 1.01e-1 SMART
ZnF_C2H2 233 256 3.78e-1 SMART
ZnF_C2H2 314 336 2.05e-2 SMART
ZnF_C2H2 641 663 2.71e-2 SMART
ZnF_C2H2 669 691 2.27e-4 SMART
ZnF_C2H2 697 720 5.81e-2 SMART
ZnF_C2H2 751 773 9.44e-2 SMART
ZnF_C2H2 788 811 2.14e0 SMART
low complexity region 916 927 N/A INTRINSIC
low complexity region 968 977 N/A INTRINSIC
low complexity region 995 1003 N/A INTRINSIC
low complexity region 1032 1062 N/A INTRINSIC
low complexity region 1071 1083 N/A INTRINSIC
low complexity region 1119 1146 N/A INTRINSIC
low complexity region 1154 1171 N/A INTRINSIC
ZnF_C2H2 1251 1273 1.5e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor that binds to RAS-responsive elements (RREs) of gene promoters. It has been shown that the calcitonin gene promoter contains an RRE and that the encoded protein binds there and increases expression of calcitonin, which may be involved in Ras/Raf-mediated cell differentiation. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T C 8: 41,278,106 (GRCm39) S166P probably damaging Het
Appl1 T A 14: 26,686,914 (GRCm39) T19S probably damaging Het
Arid4b T A 13: 14,344,594 (GRCm39) D557E probably benign Het
Aven C T 2: 112,390,120 (GRCm39) R8W probably benign Het
C2cd2l T C 9: 44,227,502 (GRCm39) E307G possibly damaging Het
Cdh20 A C 1: 110,027,832 (GRCm39) T526P probably benign Het
Dchs1 C T 7: 105,414,718 (GRCm39) V775M probably benign Het
Dennd1b A G 1: 138,969,673 (GRCm39) N63S probably benign Het
Dtnb A T 12: 3,694,056 (GRCm39) Y248F unknown Het
Ehbp1l1 T A 19: 5,770,089 (GRCm39) T405S possibly damaging Het
Fam149a A G 8: 45,803,490 (GRCm39) Y415H possibly damaging Het
Fam186a A G 15: 99,839,191 (GRCm39) L2351P unknown Het
Fsip2 T G 2: 82,819,687 (GRCm39) I5140S possibly damaging Het
Gm8674 T C 13: 50,054,262 (GRCm39) T749A noncoding transcript Het
Kalrn A G 16: 33,870,153 (GRCm39) V1894A noncoding transcript Het
Kpna3 A T 14: 61,624,919 (GRCm39) N141K probably damaging Het
Lrba G A 3: 86,449,882 (GRCm39) G2067D probably damaging Het
Lrp2 G T 2: 69,311,611 (GRCm39) Y2622* probably null Het
Lrtm2 A C 6: 119,297,778 (GRCm39) F88V probably damaging Het
Mboat1 T C 13: 30,429,333 (GRCm39) S454P probably damaging Het
Nkpd1 C T 7: 19,253,753 (GRCm39) P40S probably benign Het
Or2b7 T C 13: 21,739,788 (GRCm39) I135V probably benign Het
Or4a76 T A 2: 89,460,907 (GRCm39) I112F probably damaging Het
Or8b54 G A 9: 38,686,577 (GRCm39) V9M noncoding transcript Het
Or8k27 C A 2: 86,275,473 (GRCm39) M284I noncoding transcript Het
Patj A G 4: 98,570,308 (GRCm39) E1711G possibly damaging Het
Pcdha4 A T 18: 37,086,128 (GRCm39) I104F probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Plekhg4 C T 8: 106,107,546 (GRCm39) R990* probably null Het
Pphln1 T C 15: 93,386,930 (GRCm39) S343P probably benign Het
Pram1 A T 17: 33,860,241 (GRCm39) K269N probably damaging Het
Psmd13 T A 7: 140,466,450 (GRCm39) I79K probably damaging Het
Ptprf T C 4: 118,069,309 (GRCm39) D1586G possibly damaging Het
Ptprh T A 7: 4,584,090 (GRCm39) Q167H probably damaging Het
Rbm46 C T 3: 82,772,775 (GRCm39) R119Q probably benign Het
Scrn2 T G 11: 96,923,046 (GRCm39) L163R probably damaging Het
Slc36a3 C T 11: 55,022,433 (GRCm39) V254I probably benign Het
Slc6a6 T C 6: 91,701,951 (GRCm39) F120L probably benign Het
Slc8a2 A T 7: 15,879,230 (GRCm39) H572L probably benign Het
Spats2 T A 15: 99,106,776 (GRCm39) D357E probably damaging Het
Speg A T 1: 75,395,677 (GRCm39) N1816I probably damaging Het
Sult2b1 A G 7: 45,433,361 (GRCm39) V2A unknown Het
Susd3 T C 13: 49,384,731 (GRCm39) T231A probably benign Het
Tamalin C T 15: 101,128,902 (GRCm39) L217F probably damaging Het
Tcp1 A G 17: 13,139,738 (GRCm39) D261G probably benign Het
Trpm2 C G 10: 77,771,836 (GRCm39) S601T probably benign Het
Ugt2b38 A T 5: 87,571,659 (GRCm39) F124L probably benign Het
Unc80 G T 1: 66,693,178 (GRCm39) E2522D probably benign Het
Usp34 A G 11: 23,396,750 (GRCm39) T2365A Het
Vmn2r92 G T 17: 18,405,278 (GRCm39) M807I probably benign Het
Vps13b C A 15: 35,597,550 (GRCm39) P1030Q probably damaging Het
Wrn T G 8: 33,819,213 (GRCm39) K246N probably damaging Het
Zer1 T A 2: 29,991,147 (GRCm39) probably null Het
Other mutations in Rreb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Rreb1 APN 13 38,100,472 (GRCm39) missense probably benign 0.09
IGL00336:Rreb1 APN 13 38,113,622 (GRCm39) nonsense probably null
IGL00473:Rreb1 APN 13 38,114,767 (GRCm39) nonsense probably null
IGL01338:Rreb1 APN 13 38,115,010 (GRCm39) missense probably damaging 1.00
IGL01836:Rreb1 APN 13 38,115,433 (GRCm39) missense probably damaging 1.00
IGL02066:Rreb1 APN 13 38,115,482 (GRCm39) missense probably benign 0.16
IGL02661:Rreb1 APN 13 38,114,778 (GRCm39) nonsense probably null
IGL02739:Rreb1 APN 13 38,077,797 (GRCm39) missense probably damaging 1.00
IGL03267:Rreb1 APN 13 38,116,169 (GRCm39) missense probably benign 0.30
IGL03332:Rreb1 APN 13 38,114,892 (GRCm39) missense probably benign 0.42
IGL03403:Rreb1 APN 13 38,113,550 (GRCm39) missense possibly damaging 0.78
R0039:Rreb1 UTSW 13 38,083,613 (GRCm39) missense probably damaging 1.00
R0039:Rreb1 UTSW 13 38,083,613 (GRCm39) missense probably damaging 1.00
R0101:Rreb1 UTSW 13 38,115,518 (GRCm39) missense probably benign 0.04
R0265:Rreb1 UTSW 13 38,100,131 (GRCm39) nonsense probably null
R0635:Rreb1 UTSW 13 38,125,540 (GRCm39) missense possibly damaging 0.92
R0939:Rreb1 UTSW 13 38,116,207 (GRCm39) missense probably benign 0.09
R1099:Rreb1 UTSW 13 38,132,867 (GRCm39) missense probably benign 0.16
R1438:Rreb1 UTSW 13 38,114,581 (GRCm39) missense probably benign 0.16
R1457:Rreb1 UTSW 13 38,130,904 (GRCm39) missense possibly damaging 0.52
R1510:Rreb1 UTSW 13 38,115,860 (GRCm39) missense probably benign 0.04
R1672:Rreb1 UTSW 13 38,114,513 (GRCm39) missense probably benign 0.09
R1772:Rreb1 UTSW 13 38,114,899 (GRCm39) missense probably benign 0.09
R2171:Rreb1 UTSW 13 38,114,822 (GRCm39) missense probably benign 0.00
R2371:Rreb1 UTSW 13 38,100,513 (GRCm39) missense probably benign 0.09
R2566:Rreb1 UTSW 13 38,113,768 (GRCm39) missense possibly damaging 0.62
R2571:Rreb1 UTSW 13 38,083,613 (GRCm39) missense probably damaging 1.00
R2862:Rreb1 UTSW 13 38,116,429 (GRCm39) missense probably benign 0.02
R2874:Rreb1 UTSW 13 38,100,484 (GRCm39) missense probably benign 0.09
R2911:Rreb1 UTSW 13 38,132,896 (GRCm39) missense probably benign 0.00
R3722:Rreb1 UTSW 13 38,131,074 (GRCm39) missense probably benign 0.01
R3767:Rreb1 UTSW 13 38,113,579 (GRCm39) missense possibly damaging 0.95
R3770:Rreb1 UTSW 13 38,113,579 (GRCm39) missense possibly damaging 0.95
R3885:Rreb1 UTSW 13 38,077,941 (GRCm39) missense probably damaging 1.00
R3886:Rreb1 UTSW 13 38,082,482 (GRCm39) splice site probably null
R3887:Rreb1 UTSW 13 38,077,941 (GRCm39) missense probably damaging 1.00
R3888:Rreb1 UTSW 13 38,077,941 (GRCm39) missense probably damaging 1.00
R3889:Rreb1 UTSW 13 38,077,941 (GRCm39) missense probably damaging 1.00
R4064:Rreb1 UTSW 13 38,114,293 (GRCm39) missense probably benign 0.42
R4134:Rreb1 UTSW 13 38,131,099 (GRCm39) missense probably damaging 1.00
R4135:Rreb1 UTSW 13 38,131,099 (GRCm39) missense probably damaging 1.00
R4174:Rreb1 UTSW 13 38,114,126 (GRCm39) missense possibly damaging 0.95
R4250:Rreb1 UTSW 13 38,077,869 (GRCm39) missense possibly damaging 0.63
R4287:Rreb1 UTSW 13 38,115,907 (GRCm39) missense probably benign 0.03
R4396:Rreb1 UTSW 13 38,114,419 (GRCm39) nonsense probably null
R4658:Rreb1 UTSW 13 38,132,777 (GRCm39) missense probably damaging 1.00
R4841:Rreb1 UTSW 13 38,100,502 (GRCm39) missense probably benign 0.09
R4856:Rreb1 UTSW 13 38,115,034 (GRCm39) missense possibly damaging 0.62
R4886:Rreb1 UTSW 13 38,115,034 (GRCm39) missense possibly damaging 0.62
R5092:Rreb1 UTSW 13 38,112,254 (GRCm39) missense probably benign 0.09
R5122:Rreb1 UTSW 13 38,114,744 (GRCm39) missense probably benign 0.02
R5405:Rreb1 UTSW 13 38,133,087 (GRCm39) missense probably damaging 0.99
R5408:Rreb1 UTSW 13 38,115,320 (GRCm39) missense probably benign 0.01
R5446:Rreb1 UTSW 13 38,082,473 (GRCm39) missense possibly damaging 0.78
R5641:Rreb1 UTSW 13 38,131,397 (GRCm39) missense probably benign 0.00
R5859:Rreb1 UTSW 13 38,131,385 (GRCm39) missense probably benign 0.06
R5859:Rreb1 UTSW 13 38,131,384 (GRCm39) missense probably benign 0.24
R6429:Rreb1 UTSW 13 38,116,105 (GRCm39) missense probably benign 0.03
R6678:Rreb1 UTSW 13 38,083,675 (GRCm39) missense probably damaging 1.00
R7130:Rreb1 UTSW 13 38,083,724 (GRCm39) missense probably damaging 1.00
R7186:Rreb1 UTSW 13 38,125,608 (GRCm39) missense probably benign 0.02
R7188:Rreb1 UTSW 13 38,100,544 (GRCm39) missense possibly damaging 0.79
R7387:Rreb1 UTSW 13 38,131,040 (GRCm39) missense unknown
R7453:Rreb1 UTSW 13 38,125,545 (GRCm39) missense probably damaging 0.98
R7492:Rreb1 UTSW 13 38,115,724 (GRCm39) missense probably benign 0.00
R7585:Rreb1 UTSW 13 38,077,874 (GRCm39) missense probably benign 0.07
R7621:Rreb1 UTSW 13 38,133,042 (GRCm39) missense
R7645:Rreb1 UTSW 13 38,115,010 (GRCm39) missense probably damaging 1.00
R7653:Rreb1 UTSW 13 38,114,362 (GRCm39) missense probably benign 0.19
R7670:Rreb1 UTSW 13 38,115,548 (GRCm39) missense probably benign 0.00
R7701:Rreb1 UTSW 13 38,114,092 (GRCm39) missense possibly damaging 0.60
R7708:Rreb1 UTSW 13 38,113,546 (GRCm39) missense probably benign 0.18
R7874:Rreb1 UTSW 13 38,131,100 (GRCm39) missense probably damaging 1.00
R8103:Rreb1 UTSW 13 38,125,677 (GRCm39) missense probably benign 0.16
R8129:Rreb1 UTSW 13 38,113,775 (GRCm39) missense probably benign 0.00
R8324:Rreb1 UTSW 13 38,131,597 (GRCm39) missense probably damaging 1.00
R8824:Rreb1 UTSW 13 38,114,492 (GRCm39) missense probably damaging 0.99
R8910:Rreb1 UTSW 13 38,132,741 (GRCm39) missense
R8992:Rreb1 UTSW 13 38,114,352 (GRCm39) missense probably benign 0.30
R9064:Rreb1 UTSW 13 38,115,326 (GRCm39) missense possibly damaging 0.94
R9087:Rreb1 UTSW 13 38,115,644 (GRCm39) missense probably benign 0.33
R9130:Rreb1 UTSW 13 38,114,282 (GRCm39) missense probably benign 0.29
R9582:Rreb1 UTSW 13 38,114,734 (GRCm39) missense probably benign 0.29
R9602:Rreb1 UTSW 13 38,114,477 (GRCm39) missense probably damaging 0.99
R9774:Rreb1 UTSW 13 38,114,185 (GRCm39) missense probably benign 0.18
X0024:Rreb1 UTSW 13 38,115,556 (GRCm39) missense probably benign 0.09
X0026:Rreb1 UTSW 13 38,115,968 (GRCm39) missense probably benign 0.17
Z1088:Rreb1 UTSW 13 38,132,913 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGGGTTGAACTAGGGCAAG -3'
(R):5'- GGCAGTGTGGGAACTTCTACTC -3'

Sequencing Primer
(F):5'- TGTCTCTTTTACCATGGTAGCTATG -3'
(R):5'- AGTGTGGGAACTTCTACTCTACATTC -3'
Posted On 2020-07-13