Incidental Mutation 'R8239:Pphln1'
ID637526
Institutional Source Beutler Lab
Gene Symbol Pphln1
Ensembl Gene ENSMUSG00000036167
Gene Nameperiphilin 1
SynonymsCR, 1600022A19Rik, 1110063K05Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8239 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location93398350-93491510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93489049 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 343 (S343P)
Ref Sequence ENSEMBL: ENSMUSP00000042762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049122] [ENSMUST00000068457] [ENSMUST00000109256] [ENSMUST00000165935]
Predicted Effect probably benign
Transcript: ENSMUST00000049122
AA Change: S343P

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000042762
Gene: ENSMUSG00000036167
AA Change: S343P

DomainStartEndE-ValueType
low complexity region 35 59 N/A INTRINSIC
low complexity region 154 174 N/A INTRINSIC
low complexity region 215 231 N/A INTRINSIC
Pfam:Lge1 275 365 2.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068457
AA Change: S274P

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000068165
Gene: ENSMUSG00000036167
AA Change: S274P

DomainStartEndE-ValueType
low complexity region 85 105 N/A INTRINSIC
low complexity region 146 162 N/A INTRINSIC
Pfam:Lge1 179 297 8.6e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109256
AA Change: S255P

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000104879
Gene: ENSMUSG00000036167
AA Change: S255P

DomainStartEndE-ValueType
low complexity region 85 105 N/A INTRINSIC
low complexity region 127 143 N/A INTRINSIC
Pfam:Lge1 160 278 7.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165935
AA Change: S255P

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000131121
Gene: ENSMUSG00000036167
AA Change: S255P

DomainStartEndE-ValueType
low complexity region 85 105 N/A INTRINSIC
low complexity region 127 143 N/A INTRINSIC
Pfam:Lge1 160 278 7.1e-19 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the several proteins that become sequentially incorporated into the cornified cell envelope during the terminal differentiation of keratinocyte at the outer layers of epidermis. This protein interacts with periplakin, which is known as a precursor of the cornified cell envelope. The cellular localization pattern and insolubility of this protein suggest that it may play a role in epithelial differentiation and contribute to epidermal integrity and barrier formation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T C 8: 40,825,069 S166P probably damaging Het
Appl1 T A 14: 26,964,957 T19S probably damaging Het
Arid4b T A 13: 14,170,009 D557E probably benign Het
Aven C T 2: 112,559,775 R8W probably benign Het
C2cd2l T C 9: 44,316,205 E307G possibly damaging Het
Cdh7 A C 1: 110,100,102 T526P probably benign Het
Dchs1 C T 7: 105,765,511 V775M probably benign Het
Dennd1b A G 1: 139,041,935 N63S probably benign Het
Dtnb A T 12: 3,644,056 Y248F unknown Het
Ehbp1l1 T A 19: 5,720,061 T405S possibly damaging Het
Fam149a A G 8: 45,350,453 Y415H possibly damaging Het
Fam186a A G 15: 99,941,310 L2351P unknown Het
Fsip2 T G 2: 82,989,343 I5140S possibly damaging Het
Gm8674 T C 13: 49,900,226 T749A noncoding transcript Het
Grasp C T 15: 101,231,021 L217F probably damaging Het
Inadl A G 4: 98,682,071 E1711G possibly damaging Het
Kalrn A G 16: 34,049,783 V1894A noncoding transcript Het
Kpna3 A T 14: 61,387,470 N141K probably damaging Het
Lrba G A 3: 86,542,575 G2067D probably damaging Het
Lrp2 G T 2: 69,481,267 Y2622* probably null Het
Lrtm2 A C 6: 119,320,817 F88V probably damaging Het
Mboat1 T C 13: 30,245,350 S454P probably damaging Het
Nkpd1 C T 7: 19,519,828 P40S probably benign Het
Olfr1065 C A 2: 86,445,129 M284I noncoding transcript Het
Olfr1249 T A 2: 89,630,563 I112F probably damaging Het
Olfr1535 T C 13: 21,555,618 I135V probably benign Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pcdha4 A T 18: 36,953,075 I104F probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Plekhg4 C T 8: 105,380,914 R990* probably null Het
Pram1 A T 17: 33,641,267 K269N probably damaging Het
Psmd13 T A 7: 140,886,537 I79K probably damaging Het
Ptprf T C 4: 118,212,112 D1586G possibly damaging Het
Ptprh T A 7: 4,581,091 Q167H probably damaging Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Rreb1 T C 13: 37,893,872 M20T probably damaging Het
Scrn2 T G 11: 97,032,220 L163R probably damaging Het
Slc36a3 C T 11: 55,131,607 V254I probably benign Het
Slc6a6 T C 6: 91,724,970 F120L probably benign Het
Slc8a2 A T 7: 16,145,305 H572L probably benign Het
Spats2 T A 15: 99,208,895 D357E probably damaging Het
Speg A T 1: 75,419,033 N1816I probably damaging Het
Sult2b1 A G 7: 45,783,937 V2A unknown Het
Susd3 T C 13: 49,231,255 T231A probably benign Het
Tcp1 A G 17: 12,920,851 D261G probably benign Het
Trpm2 C G 10: 77,936,002 S601T probably benign Het
Ugt2b38 A T 5: 87,423,800 F124L probably benign Het
Unc80 G T 1: 66,654,019 E2522D probably benign Het
Usp34 A G 11: 23,446,750 T2365A Het
Vmn2r92 G T 17: 18,185,016 M807I probably benign Het
Vps13b C A 15: 35,597,404 P1030Q probably damaging Het
Wrn T G 8: 33,329,185 K246N probably damaging Het
Zer1 T A 2: 30,101,135 probably null Het
Other mutations in Pphln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Pphln1 APN 15 93465210 missense probably damaging 1.00
IGL01305:Pphln1 APN 15 93489104 missense probably damaging 1.00
IGL01651:Pphln1 APN 15 93488983 missense probably damaging 1.00
IGL03219:Pphln1 APN 15 93465255 splice site probably benign
ANU22:Pphln1 UTSW 15 93489104 missense probably damaging 1.00
R0294:Pphln1 UTSW 15 93420290 missense probably damaging 1.00
R0309:Pphln1 UTSW 15 93441707 missense possibly damaging 0.55
R0645:Pphln1 UTSW 15 93420311 missense possibly damaging 0.80
R1208:Pphln1 UTSW 15 93459729 missense probably damaging 1.00
R1208:Pphln1 UTSW 15 93459729 missense probably damaging 1.00
R1879:Pphln1 UTSW 15 93424046 missense probably damaging 0.99
R1936:Pphln1 UTSW 15 93488987 missense possibly damaging 0.79
R4049:Pphln1 UTSW 15 93465106 missense probably damaging 0.99
R5034:Pphln1 UTSW 15 93452129 missense probably benign
R5472:Pphln1 UTSW 15 93488975 missense possibly damaging 0.89
R5945:Pphln1 UTSW 15 93455532 critical splice donor site probably null
R7116:Pphln1 UTSW 15 93455525 missense probably benign 0.10
R7989:Pphln1 UTSW 15 93489079 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CCCTTACAGGTTTCAGCAGC -3'
(R):5'- GTTAAATACAGGGAGCTGCTCTC -3'

Sequencing Primer
(F):5'- ACAGGTTTCAGCAGCTGAGTTCTAC -3'
(R):5'- AACTGAATATTATTTTTGGAGGGAGG -3'
Posted On2020-07-13