Incidental Mutation 'R8239:Fam186a'
ID637528
Institutional Source Beutler Lab
Gene Symbol Fam186a
Ensembl Gene ENSMUSG00000045350
Gene Namefamily with sequence similarity 186, member A
SynonymsLOC380973, 1700030F18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R8239 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location99918348-99967061 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99941310 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 2351 (L2351P)
Ref Sequence ENSEMBL: ENSMUSP00000097783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100209]
Predicted Effect unknown
Transcript: ENSMUST00000100209
AA Change: L2351P
SMART Domains Protein: ENSMUSP00000097783
Gene: ENSMUSG00000045350
AA Change: L2351P

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:FBG 44 222 4e-48 BLAST
coiled coil region 292 340 N/A INTRINSIC
low complexity region 423 443 N/A INTRINSIC
low complexity region 446 458 N/A INTRINSIC
low complexity region 632 644 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
internal_repeat_2 743 1156 1.05e-58 PROSPERO
internal_repeat_1 833 1270 7.71e-59 PROSPERO
low complexity region 1271 1285 N/A INTRINSIC
low complexity region 1289 1300 N/A INTRINSIC
low complexity region 1309 1323 N/A INTRINSIC
low complexity region 1327 1338 N/A INTRINSIC
low complexity region 1347 1361 N/A INTRINSIC
low complexity region 1365 1376 N/A INTRINSIC
low complexity region 1384 1395 N/A INTRINSIC
low complexity region 1403 1414 N/A INTRINSIC
low complexity region 1423 1437 N/A INTRINSIC
low complexity region 1441 1452 N/A INTRINSIC
low complexity region 1460 1471 N/A INTRINSIC
low complexity region 1479 1490 N/A INTRINSIC
low complexity region 1498 1509 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1536 1547 N/A INTRINSIC
low complexity region 1555 1566 N/A INTRINSIC
low complexity region 1574 1585 N/A INTRINSIC
internal_repeat_1 1586 1981 7.71e-59 PROSPERO
internal_repeat_2 1737 2197 1.05e-58 PROSPERO
low complexity region 2367 2378 N/A INTRINSIC
low complexity region 2549 2564 N/A INTRINSIC
low complexity region 2644 2655 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T C 8: 40,825,069 S166P probably damaging Het
Appl1 T A 14: 26,964,957 T19S probably damaging Het
Arid4b T A 13: 14,170,009 D557E probably benign Het
Aven C T 2: 112,559,775 R8W probably benign Het
C2cd2l T C 9: 44,316,205 E307G possibly damaging Het
Cdh7 A C 1: 110,100,102 T526P probably benign Het
Dchs1 C T 7: 105,765,511 V775M probably benign Het
Dennd1b A G 1: 139,041,935 N63S probably benign Het
Dtnb A T 12: 3,644,056 Y248F unknown Het
Ehbp1l1 T A 19: 5,720,061 T405S possibly damaging Het
Fam149a A G 8: 45,350,453 Y415H possibly damaging Het
Fsip2 T G 2: 82,989,343 I5140S possibly damaging Het
Gm8674 T C 13: 49,900,226 T749A noncoding transcript Het
Grasp C T 15: 101,231,021 L217F probably damaging Het
Inadl A G 4: 98,682,071 E1711G possibly damaging Het
Kalrn A G 16: 34,049,783 V1894A noncoding transcript Het
Kpna3 A T 14: 61,387,470 N141K probably damaging Het
Lrba G A 3: 86,542,575 G2067D probably damaging Het
Lrp2 G T 2: 69,481,267 Y2622* probably null Het
Lrtm2 A C 6: 119,320,817 F88V probably damaging Het
Mboat1 T C 13: 30,245,350 S454P probably damaging Het
Nkpd1 C T 7: 19,519,828 P40S probably benign Het
Olfr1065 C A 2: 86,445,129 M284I noncoding transcript Het
Olfr1249 T A 2: 89,630,563 I112F probably damaging Het
Olfr1535 T C 13: 21,555,618 I135V probably benign Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pcdha4 A T 18: 36,953,075 I104F probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Plekhg4 C T 8: 105,380,914 R990* probably null Het
Pphln1 T C 15: 93,489,049 S343P probably benign Het
Pram1 A T 17: 33,641,267 K269N probably damaging Het
Psmd13 T A 7: 140,886,537 I79K probably damaging Het
Ptprf T C 4: 118,212,112 D1586G possibly damaging Het
Ptprh T A 7: 4,581,091 Q167H probably damaging Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Rreb1 T C 13: 37,893,872 M20T probably damaging Het
Scrn2 T G 11: 97,032,220 L163R probably damaging Het
Slc36a3 C T 11: 55,131,607 V254I probably benign Het
Slc6a6 T C 6: 91,724,970 F120L probably benign Het
Slc8a2 A T 7: 16,145,305 H572L probably benign Het
Spats2 T A 15: 99,208,895 D357E probably damaging Het
Speg A T 1: 75,419,033 N1816I probably damaging Het
Sult2b1 A G 7: 45,783,937 V2A unknown Het
Susd3 T C 13: 49,231,255 T231A probably benign Het
Tcp1 A G 17: 12,920,851 D261G probably benign Het
Trpm2 C G 10: 77,936,002 S601T probably benign Het
Ugt2b38 A T 5: 87,423,800 F124L probably benign Het
Unc80 G T 1: 66,654,019 E2522D probably benign Het
Usp34 A G 11: 23,446,750 T2365A Het
Vmn2r92 G T 17: 18,185,016 M807I probably benign Het
Vps13b C A 15: 35,597,404 P1030Q probably damaging Het
Wrn T G 8: 33,329,185 K246N probably damaging Het
Zer1 T A 2: 30,101,135 probably null Het
Other mutations in Fam186a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Fam186a APN 15 99927691 splice site probably benign
IGL03047:Fam186a UTSW 15 99945708 missense unknown
R0172:Fam186a UTSW 15 99954887 missense unknown
R0194:Fam186a UTSW 15 99941763 missense possibly damaging 0.92
R0381:Fam186a UTSW 15 99942174 missense probably damaging 0.97
R0799:Fam186a UTSW 15 99942012 missense probably damaging 1.00
R1295:Fam186a UTSW 15 99939789 splice site probably benign
R1366:Fam186a UTSW 15 99943389 missense possibly damaging 0.89
R1519:Fam186a UTSW 15 99947655 missense unknown
R1592:Fam186a UTSW 15 99940318 missense probably benign 0.01
R1636:Fam186a UTSW 15 99941658 missense unknown
R1719:Fam186a UTSW 15 99942346 missense possibly damaging 0.54
R1759:Fam186a UTSW 15 99966881 nonsense probably null
R1856:Fam186a UTSW 15 99940302 missense possibly damaging 0.82
R2131:Fam186a UTSW 15 99933676 unclassified probably benign
R2192:Fam186a UTSW 15 99940311 missense possibly damaging 0.90
R2239:Fam186a UTSW 15 99954864 missense unknown
R2251:Fam186a UTSW 15 99945097 missense probably benign 0.02
R2902:Fam186a UTSW 15 99945168 missense possibly damaging 0.73
R3037:Fam186a UTSW 15 99943794 missense probably damaging 0.99
R3744:Fam186a UTSW 15 99947535 missense unknown
R4021:Fam186a UTSW 15 99941799 missense possibly damaging 0.66
R4183:Fam186a UTSW 15 99933685 unclassified probably benign
R4238:Fam186a UTSW 15 99943642 missense probably benign 0.05
R4667:Fam186a UTSW 15 99944532 missense possibly damaging 0.92
R4817:Fam186a UTSW 15 99933538 unclassified probably benign
R4835:Fam186a UTSW 15 99945808 missense unknown
R4837:Fam186a UTSW 15 99940797 missense unknown
R4897:Fam186a UTSW 15 99945277 missense possibly damaging 0.66
R4902:Fam186a UTSW 15 99946842 missense unknown
R4950:Fam186a UTSW 15 99941653 missense unknown
R4995:Fam186a UTSW 15 99945099 missense probably benign 0.27
R5062:Fam186a UTSW 15 99944646 missense possibly damaging 0.66
R5124:Fam186a UTSW 15 99943096 missense possibly damaging 0.90
R5133:Fam186a UTSW 15 99955493 missense unknown
R5424:Fam186a UTSW 15 99945763 missense unknown
R5624:Fam186a UTSW 15 99941747 missense possibly damaging 0.90
R5628:Fam186a UTSW 15 99941747 missense possibly damaging 0.90
R5637:Fam186a UTSW 15 99941747 missense possibly damaging 0.90
R5639:Fam186a UTSW 15 99947050 missense unknown
R5652:Fam186a UTSW 15 99945372 missense possibly damaging 0.79
R5673:Fam186a UTSW 15 99941747 missense possibly damaging 0.90
R5799:Fam186a UTSW 15 99966824 nonsense probably null
R5965:Fam186a UTSW 15 99945097 missense probably benign 0.37
R6044:Fam186a UTSW 15 99941997 missense probably damaging 0.97
R6077:Fam186a UTSW 15 99942703 missense possibly damaging 0.46
R6120:Fam186a UTSW 15 99940363 missense probably benign 0.00
R6185:Fam186a UTSW 15 99947649 missense unknown
R6186:Fam186a UTSW 15 99947325 missense unknown
R6242:Fam186a UTSW 15 99939907 missense unknown
R6351:Fam186a UTSW 15 99941742 missense probably damaging 0.97
R6368:Fam186a UTSW 15 99943317 missense possibly damaging 0.66
R6369:Fam186a UTSW 15 99947331 missense unknown
R6559:Fam186a UTSW 15 99944475 missense possibly damaging 0.46
R6855:Fam186a UTSW 15 99954875 missense unknown
R6867:Fam186a UTSW 15 99945850 missense unknown
R6957:Fam186a UTSW 15 99946476 missense unknown
R6961:Fam186a UTSW 15 99940201 missense probably benign 0.16
R6994:Fam186a UTSW 15 99942466 missense probably benign 0.35
R6996:Fam186a UTSW 15 99955493 missense unknown
R7062:Fam186a UTSW 15 99933640 unclassified probably benign
R7064:Fam186a UTSW 15 99941676 missense unknown
R7173:Fam186a UTSW 15 99945650 missense unknown
R7244:Fam186a UTSW 15 99946392 missense unknown
R7270:Fam186a UTSW 15 99944152 missense possibly damaging 0.66
R7410:Fam186a UTSW 15 99946945 nonsense probably null
R7437:Fam186a UTSW 15 99942894 missense probably damaging 1.00
R7475:Fam186a UTSW 15 99947514 missense unknown
R7487:Fam186a UTSW 15 99942136 missense possibly damaging 0.66
R7526:Fam186a UTSW 15 99941915 missense possibly damaging 0.83
R7650:Fam186a UTSW 15 99939907 missense unknown
R7658:Fam186a UTSW 15 99939844 missense unknown
R7663:Fam186a UTSW 15 99945069 missense probably benign 0.00
R7703:Fam186a UTSW 15 99954797 missense unknown
R7814:Fam186a UTSW 15 99944664 missense possibly damaging 0.92
R7958:Fam186a UTSW 15 99943308 missense probably damaging 0.99
R7970:Fam186a UTSW 15 99933586 missense unknown
R8076:Fam186a UTSW 15 99943470 missense possibly damaging 0.83
R8087:Fam186a UTSW 15 99941844 missense possibly damaging 0.46
R8130:Fam186a UTSW 15 99944033 frame shift probably null
R8246:Fam186a UTSW 15 99940547 missense unknown
X0021:Fam186a UTSW 15 99945435 missense probably benign 0.00
Z1088:Fam186a UTSW 15 99945994 missense unknown
Predicted Primers PCR Primer
(F):5'- CTCCAAGCCAGATTCTCAGTG -3'
(R):5'- CCCAACCATTCCAGGCATTTG -3'

Sequencing Primer
(F):5'- CAGATTCTCAGTGAGAGCGTC -3'
(R):5'- CCAGGCATTTGGAGCTCTAC -3'
Posted On2020-07-13