Incidental Mutation 'R8239:Pcdha4'
ID637534
Institutional Source Beutler Lab
Gene Symbol Pcdha4
Ensembl Gene ENSMUSG00000104252
Gene Nameprotocadherin alpha 4
SynonymsCnr1, Crnr1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R8239 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location36952648-37187661 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36953075 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 104 (I104F)
Ref Sequence ENSEMBL: ENSMUSP00000141408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070797] [ENSMUST00000115661] [ENSMUST00000115662] [ENSMUST00000192295] [ENSMUST00000192503] [ENSMUST00000192512] [ENSMUST00000193839] [ENSMUST00000195590]
Predicted Effect probably benign
Transcript: ENSMUST00000070797
SMART Domains Protein: ENSMUSP00000068828
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Pfam:Cadherin_tail 797 931 5.3e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115661
AA Change: I104F

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458
AA Change: I104F

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115662
SMART Domains Protein: ENSMUSP00000111326
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 916 940 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192295
AA Change: I104F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142103
Gene: ENSMUSG00000104252
AA Change: I104F

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 568 5.38e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192503
SMART Domains Protein: ENSMUSP00000141989
Gene: ENSMUSG00000102312

DomainStartEndE-ValueType
low complexity region 11 17 N/A INTRINSIC
CA 42 128 3.78e-2 SMART
CA 152 237 8.94e-22 SMART
CA 261 345 3.74e-24 SMART
CA 369 450 1.09e-25 SMART
CA 474 560 1.42e-24 SMART
CA 588 670 2.96e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 910 934 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192512
AA Change: I104F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000141408
Gene: ENSMUSG00000104252
AA Change: I104F

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
low complexity region 915 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193839
SMART Domains Protein: ENSMUSP00000142308
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195590
SMART Domains Protein: ENSMUSP00000141355
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T C 8: 40,825,069 S166P probably damaging Het
Appl1 T A 14: 26,964,957 T19S probably damaging Het
Arid4b T A 13: 14,170,009 D557E probably benign Het
Aven C T 2: 112,559,775 R8W probably benign Het
C2cd2l T C 9: 44,316,205 E307G possibly damaging Het
Cdh7 A C 1: 110,100,102 T526P probably benign Het
Dchs1 C T 7: 105,765,511 V775M probably benign Het
Dennd1b A G 1: 139,041,935 N63S probably benign Het
Dtnb A T 12: 3,644,056 Y248F unknown Het
Ehbp1l1 T A 19: 5,720,061 T405S possibly damaging Het
Fam149a A G 8: 45,350,453 Y415H possibly damaging Het
Fam186a A G 15: 99,941,310 L2351P unknown Het
Fsip2 T G 2: 82,989,343 I5140S possibly damaging Het
Gm8674 T C 13: 49,900,226 T749A noncoding transcript Het
Grasp C T 15: 101,231,021 L217F probably damaging Het
Inadl A G 4: 98,682,071 E1711G possibly damaging Het
Kalrn A G 16: 34,049,783 V1894A noncoding transcript Het
Kpna3 A T 14: 61,387,470 N141K probably damaging Het
Lrba G A 3: 86,542,575 G2067D probably damaging Het
Lrp2 G T 2: 69,481,267 Y2622* probably null Het
Lrtm2 A C 6: 119,320,817 F88V probably damaging Het
Mboat1 T C 13: 30,245,350 S454P probably damaging Het
Nkpd1 C T 7: 19,519,828 P40S probably benign Het
Olfr1065 C A 2: 86,445,129 M284I noncoding transcript Het
Olfr1249 T A 2: 89,630,563 I112F probably damaging Het
Olfr1535 T C 13: 21,555,618 I135V probably benign Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Plekhg4 C T 8: 105,380,914 R990* probably null Het
Pphln1 T C 15: 93,489,049 S343P probably benign Het
Pram1 A T 17: 33,641,267 K269N probably damaging Het
Psmd13 T A 7: 140,886,537 I79K probably damaging Het
Ptprf T C 4: 118,212,112 D1586G possibly damaging Het
Ptprh T A 7: 4,581,091 Q167H probably damaging Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Rreb1 T C 13: 37,893,872 M20T probably damaging Het
Scrn2 T G 11: 97,032,220 L163R probably damaging Het
Slc36a3 C T 11: 55,131,607 V254I probably benign Het
Slc6a6 T C 6: 91,724,970 F120L probably benign Het
Slc8a2 A T 7: 16,145,305 H572L probably benign Het
Spats2 T A 15: 99,208,895 D357E probably damaging Het
Speg A T 1: 75,419,033 N1816I probably damaging Het
Sult2b1 A G 7: 45,783,937 V2A unknown Het
Susd3 T C 13: 49,231,255 T231A probably benign Het
Tcp1 A G 17: 12,920,851 D261G probably benign Het
Trpm2 C G 10: 77,936,002 S601T probably benign Het
Ugt2b38 A T 5: 87,423,800 F124L probably benign Het
Unc80 G T 1: 66,654,019 E2522D probably benign Het
Usp34 A G 11: 23,446,750 T2365A Het
Vmn2r92 G T 17: 18,185,016 M807I probably benign Het
Vps13b C A 15: 35,597,404 P1030Q probably damaging Het
Wrn T G 8: 33,329,185 K246N probably damaging Het
Zer1 T A 2: 30,101,135 probably null Het
Other mutations in Pcdha4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2570:Pcdha4 UTSW 18 36953612 missense probably benign 0.00
R3114:Pcdha4 UTSW 18 36953550 missense probably benign 0.02
R3115:Pcdha4 UTSW 18 36953550 missense probably benign 0.02
R4154:Pcdha4 UTSW 18 36953586 intron probably null
R4381:Pcdha4 UTSW 18 36952875 missense probably damaging 1.00
R4389:Pcdha4 UTSW 18 36954789 missense probably benign
R4493:Pcdha4 UTSW 18 36954591 missense possibly damaging 0.80
R4801:Pcdha4 UTSW 18 36953955 nonsense probably null
R4802:Pcdha4 UTSW 18 36953955 nonsense probably null
R4827:Pcdha4 UTSW 18 36953198 missense probably damaging 1.00
R4928:Pcdha4 UTSW 18 36954816 missense probably benign 0.01
R5001:Pcdha4 UTSW 18 36954948 missense probably benign
R5330:Pcdha4 UTSW 18 36954702 missense probably benign 0.01
R5331:Pcdha4 UTSW 18 36954702 missense probably benign 0.01
R5540:Pcdha4 UTSW 18 36954837 missense probably benign 0.01
R5587:Pcdha4 UTSW 18 36954822 missense probably benign
R5931:Pcdha4 UTSW 18 36954755 missense probably damaging 1.00
R6249:Pcdha4 UTSW 18 36953676 missense probably damaging 0.99
R6427:Pcdha4 UTSW 18 36953733 missense probably benign 0.00
R6612:Pcdha4 UTSW 18 36954978 missense probably benign 0.00
R6616:Pcdha4 UTSW 18 36953900 missense probably benign
R7030:Pcdha4 UTSW 18 36954027 missense probably damaging 1.00
R7198:Pcdha4 UTSW 18 36953560 missense probably damaging 0.99
R7411:Pcdha4 UTSW 18 36953058 missense probably benign 0.01
R7491:Pcdha4 UTSW 18 36954636 missense probably damaging 1.00
R7513:Pcdha4 UTSW 18 36953339 missense probably damaging 1.00
R7544:Pcdha4 UTSW 18 36953723 missense probably benign 0.05
R7735:Pcdha4 UTSW 18 36952908 missense probably damaging 1.00
R7753:Pcdha4 UTSW 18 36953301 missense possibly damaging 0.49
R8104:Pcdha4 UTSW 18 36954053 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCACTACTCCATCCCTGAGG -3'
(R):5'- TGATTCCGATATCTGCGTCTGAAG -3'

Sequencing Primer
(F):5'- TCCCTGAGGAGGCCAAAC -3'
(R):5'- TGAAGCGCCCTCTAGTGGAAAC -3'
Posted On2020-07-13