Incidental Mutation 'R8241:Kcna2'
ID 637543
Institutional Source Beutler Lab
Gene Symbol Kcna2
Ensembl Gene ENSMUSG00000040724
Gene Name potassium voltage-gated channel, shaker-related subfamily, member 2
Synonyms Mk-2, Akr6a4, Kca1-2, Kv1.2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8241 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 107101146-107115005 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 107105022 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 306 (K306N)
Ref Sequence ENSEMBL: ENSMUSP00000041702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038695] [ENSMUST00000196403] [ENSMUST00000197470]
AlphaFold P63141
Predicted Effect probably damaging
Transcript: ENSMUST00000038695
AA Change: K306N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041702
Gene: ENSMUSG00000040724
AA Change: K306N

DomainStartEndE-ValueType
BTB 33 133 1.2e-9 SMART
Pfam:Ion_trans 162 421 6.2e-53 PFAM
Pfam:Ion_trans_2 329 414 4.9e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196403
AA Change: K306N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142873
Gene: ENSMUSG00000040724
AA Change: K306N

DomainStartEndE-ValueType
BTB 33 133 1.2e-9 SMART
low complexity region 164 179 N/A INTRINSIC
Pfam:Ion_trans 224 409 1.3e-36 PFAM
Pfam:Ion_trans_2 329 414 7.9e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000197470
AA Change: K306N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143798
Gene: ENSMUSG00000040724
AA Change: K306N

DomainStartEndE-ValueType
BTB 33 133 1.2e-9 SMART
Pfam:Ion_trans 162 421 6.2e-53 PFAM
Pfam:Ion_trans_2 329 414 4.9e-16 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.1%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class, members of which allow nerve cells to efficiently repolarize following an action potential. The coding region of this gene is intronless, and the gene is clustered with genes KCNA3 and KCNA10 on chromosome 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality, increased susceptibility to spontaneous and chemically-induced seizures and altered neuron electrophysiology. Mice homozygous for an ENU-induced allele exhibit abnormal gait, impaired coordination, and premature lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,188,630 R1233G probably null Het
Acacb A T 5: 114,195,236 I474F possibly damaging Het
Adora1 A T 1: 134,203,324 V203D probably damaging Het
Aff4 A G 11: 53,400,171 S653G probably benign Het
Agtr1a T C 13: 30,381,099 V49A probably damaging Het
Ahnak T C 19: 9,007,295 V1981A probably benign Het
Arhgap5 T G 12: 52,518,315 Y690D probably benign Het
Bbs9 A G 9: 22,678,918 I651V probably benign Het
Brms1 C T 19: 5,045,979 A27V probably benign Het
Camta1 A G 4: 151,083,825 V256A probably benign Het
Capg G T 6: 72,556,253 probably null Het
Chpt1 T C 10: 88,453,091 K154E Het
Cyp1b1 T C 17: 79,713,794 E173G probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbxw27 T G 9: 109,773,215 N230T possibly damaging Het
Fer1l4 T C 2: 156,049,665 T126A probably benign Het
Fut10 C A 8: 31,260,006 S440* probably null Het
Gbf1 T C 19: 46,246,137 V71A probably damaging Het
Gpatch8 T C 11: 102,487,521 E201G unknown Het
Hic2 A G 16: 17,259,086 Y593C probably damaging Het
Hlcs A T 16: 94,267,818 V181E probably damaging Het
Itpr2 A T 6: 146,418,515 I176N possibly damaging Het
Kcnb1 A G 2: 167,106,197 Y244H probably damaging Het
Klhl8 C T 5: 103,867,526 V511I probably damaging Het
Mapk14 T A 17: 28,715,400 D88E possibly damaging Het
March10 C A 11: 105,389,915 A515S probably benign Het
Mrpl1 T A 5: 96,238,874 L241I probably damaging Het
Mybpc1 A T 10: 88,536,424 N781K probably benign Het
Nfkb2 T A 19: 46,307,615 D186E probably benign Het
Olfr401 G A 11: 74,122,209 V307I probably benign Het
Plcl1 A G 1: 55,695,817 I106V probably benign Het
Ppp4r2 A G 6: 100,865,083 I168M probably damaging Het
Prpf4b A T 13: 34,895,991 K779N probably damaging Het
Qrich1 T C 9: 108,556,561 probably null Het
Rgs12 T C 5: 34,965,773 F300S probably damaging Het
Sart3 T A 5: 113,745,968 K661M probably benign Het
Scyl2 T C 10: 89,654,109 I464V possibly damaging Het
Sema5a A G 15: 32,574,918 T391A probably benign Het
Sh3bgr A G 16: 96,223,870 T183A unknown Het
Sh3rf3 C T 10: 59,104,420 P688S probably benign Het
Themis3 T C 17: 66,559,967 T93A probably benign Het
Thsd7b T A 1: 130,189,951 S1402T probably damaging Het
Ubr1 A T 2: 120,963,456 D82E possibly damaging Het
Vmn1r223 T C 13: 23,249,812 F192S probably benign Het
Vmn2r98 A G 17: 19,080,769 K678E probably damaging Het
Vps13d G T 4: 145,148,477 T1826N Het
Vps41 A G 13: 18,848,998 D633G possibly damaging Het
Wdr3 A T 3: 100,149,943 I448N probably damaging Het
Other mutations in Kcna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Kcna2 APN 3 107104630 missense probably damaging 1.00
IGL00711:Kcna2 APN 3 107104753 missense probably benign
IGL02380:Kcna2 APN 3 107104958 missense probably benign 0.00
grim UTSW 3 107105027 missense probably damaging 1.00
IGL03097:Kcna2 UTSW 3 107105399 missense probably benign 0.02
R0117:Kcna2 UTSW 3 107105354 missense probably damaging 1.00
R0200:Kcna2 UTSW 3 107105160 missense probably benign
R0463:Kcna2 UTSW 3 107105160 missense probably benign
R0472:Kcna2 UTSW 3 107105516 missense probably benign
R0662:Kcna2 UTSW 3 107105401 missense probably benign
R0746:Kcna2 UTSW 3 107105168 missense probably benign
R1838:Kcna2 UTSW 3 107104512 missense probably benign
R1847:Kcna2 UTSW 3 107105113 missense possibly damaging 0.54
R1912:Kcna2 UTSW 3 107105401 missense probably benign
R1966:Kcna2 UTSW 3 107104630 missense probably damaging 1.00
R1971:Kcna2 UTSW 3 107104824 missense probably damaging 1.00
R2419:Kcna2 UTSW 3 107104153 missense probably benign 0.21
R3796:Kcna2 UTSW 3 107105590 missense probably benign 0.37
R3830:Kcna2 UTSW 3 107104796 missense probably benign 0.04
R4273:Kcna2 UTSW 3 107105193 missense probably benign 0.00
R4570:Kcna2 UTSW 3 107104795 missense probably benign
R4662:Kcna2 UTSW 3 107105417 missense probably benign
R4756:Kcna2 UTSW 3 107105417 missense probably benign
R5054:Kcna2 UTSW 3 107104340 missense probably damaging 1.00
R5069:Kcna2 UTSW 3 107104637 missense probably damaging 1.00
R5070:Kcna2 UTSW 3 107104637 missense probably damaging 1.00
R5126:Kcna2 UTSW 3 107104234 missense probably damaging 1.00
R5146:Kcna2 UTSW 3 107105498 missense probably benign 0.00
R5205:Kcna2 UTSW 3 107097146 unclassified probably benign
R5472:Kcna2 UTSW 3 107105309 missense possibly damaging 0.93
R6687:Kcna2 UTSW 3 107105027 missense probably damaging 1.00
R6689:Kcna2 UTSW 3 107105027 missense probably damaging 1.00
R7216:Kcna2 UTSW 3 107104793 missense probably damaging 0.99
R7304:Kcna2 UTSW 3 107104750 missense probably benign
R7538:Kcna2 UTSW 3 107104568 missense probably benign 0.31
R7585:Kcna2 UTSW 3 107105342 missense probably damaging 1.00
R7968:Kcna2 UTSW 3 107105144 missense possibly damaging 0.79
R9223:Kcna2 UTSW 3 107104990 missense possibly damaging 0.93
R9441:Kcna2 UTSW 3 107104952 missense probably benign
R9449:Kcna2 UTSW 3 107105571 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGCTTCTTCACCAACATCATG -3'
(R):5'- GGAACCATGTCTCCATAGCCTAC -3'

Sequencing Primer
(F):5'- CATGAACATCATTGACATTGTGGC -3'
(R):5'- CCATAGCCTACAGTTGTCATGGAG -3'
Posted On 2020-07-13