Incidental Mutation 'R8241:Aff4'
ID 637563
Institutional Source Beutler Lab
Gene Symbol Aff4
Ensembl Gene ENSMUSG00000049470
Gene Name AF4/FMR2 family, member 4
Synonyms Laf4l, Alf4
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8241 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 53350833-53421830 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 53400171 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 653 (S653G)
Ref Sequence ENSEMBL: ENSMUSP00000051479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060945]
AlphaFold Q9ESC8
Predicted Effect probably benign
Transcript: ENSMUST00000060945
AA Change: S653G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000051479
Gene: ENSMUSG00000049470
AA Change: S653G

DomainStartEndE-ValueType
Pfam:AF-4 2 1156 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152616
SMART Domains Protein: ENSMUSP00000118866
Gene: ENSMUSG00000049470

DomainStartEndE-ValueType
Pfam:AF-4 1 51 4e-15 PFAM
Pfam:AF-4 46 159 1.3e-30 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.1%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AF4 family of transcription factors involved in leukemia. It is a component of the positive transcription elongation factor b (P-TEFb) complex. A chromosomal translocation involving this gene and MLL gene on chromosome 11 is found in infant acute lymphoblastic leukemia with ins(5;11)(q31;q31q23). [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display embryonic and neonatal lethality with incomplete penetrance, abnormal respiration, and shrunken alveoli. Surviving males are infertile with azoospermia and arrest of spermatogenesis but, do not develop hematological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,188,630 R1233G probably null Het
Acacb A T 5: 114,195,236 I474F possibly damaging Het
Adora1 A T 1: 134,203,324 V203D probably damaging Het
Agtr1a T C 13: 30,381,099 V49A probably damaging Het
Ahnak T C 19: 9,007,295 V1981A probably benign Het
Arhgap5 T G 12: 52,518,315 Y690D probably benign Het
Bbs9 A G 9: 22,678,918 I651V probably benign Het
Brms1 C T 19: 5,045,979 A27V probably benign Het
Camta1 A G 4: 151,083,825 V256A probably benign Het
Capg G T 6: 72,556,253 probably null Het
Chpt1 T C 10: 88,453,091 K154E Het
Cyp1b1 T C 17: 79,713,794 E173G probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbxw27 T G 9: 109,773,215 N230T possibly damaging Het
Fer1l4 T C 2: 156,049,665 T126A probably benign Het
Fut10 C A 8: 31,260,006 S440* probably null Het
Gbf1 T C 19: 46,246,137 V71A probably damaging Het
Gpatch8 T C 11: 102,487,521 E201G unknown Het
Hic2 A G 16: 17,259,086 Y593C probably damaging Het
Hlcs A T 16: 94,267,818 V181E probably damaging Het
Itpr2 A T 6: 146,418,515 I176N possibly damaging Het
Kcna2 G T 3: 107,105,022 K306N probably damaging Het
Kcnb1 A G 2: 167,106,197 Y244H probably damaging Het
Klhl8 C T 5: 103,867,526 V511I probably damaging Het
Mapk14 T A 17: 28,715,400 D88E possibly damaging Het
March10 C A 11: 105,389,915 A515S probably benign Het
Mrpl1 T A 5: 96,238,874 L241I probably damaging Het
Mybpc1 A T 10: 88,536,424 N781K probably benign Het
Nfkb2 T A 19: 46,307,615 D186E probably benign Het
Olfr401 G A 11: 74,122,209 V307I probably benign Het
Plcl1 A G 1: 55,695,817 I106V probably benign Het
Ppp4r2 A G 6: 100,865,083 I168M probably damaging Het
Prpf4b A T 13: 34,895,991 K779N probably damaging Het
Qrich1 T C 9: 108,556,561 probably null Het
Rgs12 T C 5: 34,965,773 F300S probably damaging Het
Sart3 T A 5: 113,745,968 K661M probably benign Het
Scyl2 T C 10: 89,654,109 I464V possibly damaging Het
Sema5a A G 15: 32,574,918 T391A probably benign Het
Sh3bgr A G 16: 96,223,870 T183A unknown Het
Sh3rf3 C T 10: 59,104,420 P688S probably benign Het
Themis3 T C 17: 66,559,967 T93A probably benign Het
Thsd7b T A 1: 130,189,951 S1402T probably damaging Het
Ubr1 A T 2: 120,963,456 D82E possibly damaging Het
Vmn1r223 T C 13: 23,249,812 F192S probably benign Het
Vmn2r98 A G 17: 19,080,769 K678E probably damaging Het
Vps13d G T 4: 145,148,477 T1826N Het
Vps41 A G 13: 18,848,998 D633G possibly damaging Het
Wdr3 A T 3: 100,149,943 I448N probably damaging Het
Other mutations in Aff4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Aff4 APN 11 53411990 missense probably damaging 0.98
IGL01348:Aff4 APN 11 53402500 missense probably benign
IGL01446:Aff4 APN 11 53415469 missense probably damaging 0.99
IGL02151:Aff4 APN 11 53399806 missense probably benign
IGL02526:Aff4 APN 11 53406682 splice site probably benign
IGL02567:Aff4 APN 11 53372751 missense possibly damaging 0.64
IGL02633:Aff4 APN 11 53409371 splice site probably benign
IGL02707:Aff4 APN 11 53399740 missense probably benign
R0090:Aff4 UTSW 11 53392782 missense probably benign 0.01
R0128:Aff4 UTSW 11 53415466 missense probably damaging 0.99
R0243:Aff4 UTSW 11 53397858 missense possibly damaging 0.74
R0345:Aff4 UTSW 11 53372881 missense probably benign 0.00
R0347:Aff4 UTSW 11 53400088 missense probably benign 0.01
R0732:Aff4 UTSW 11 53375596 missense probably benign
R0737:Aff4 UTSW 11 53410953 nonsense probably null
R1464:Aff4 UTSW 11 53372524 missense probably damaging 0.97
R1464:Aff4 UTSW 11 53372524 missense probably damaging 0.97
R1500:Aff4 UTSW 11 53372378 missense probably benign 0.00
R1693:Aff4 UTSW 11 53396553 missense probably damaging 1.00
R1743:Aff4 UTSW 11 53368695 missense possibly damaging 0.65
R1961:Aff4 UTSW 11 53372999 missense probably damaging 1.00
R2048:Aff4 UTSW 11 53398385 missense probably benign 0.39
R2138:Aff4 UTSW 11 53372512 missense possibly damaging 0.94
R2155:Aff4 UTSW 11 53399619 missense probably damaging 1.00
R2379:Aff4 UTSW 11 53408478 splice site probably benign
R4156:Aff4 UTSW 11 53410899 intron probably benign
R5001:Aff4 UTSW 11 53404357 missense probably damaging 1.00
R5281:Aff4 UTSW 11 53372288 missense probably damaging 1.00
R5477:Aff4 UTSW 11 53408472 critical splice donor site probably null
R5677:Aff4 UTSW 11 53400275 missense possibly damaging 0.55
R5992:Aff4 UTSW 11 53373010 missense probably damaging 0.99
R6576:Aff4 UTSW 11 53400441 missense probably damaging 1.00
R6764:Aff4 UTSW 11 53399830 missense probably damaging 1.00
R6988:Aff4 UTSW 11 53398237 missense probably damaging 1.00
R7034:Aff4 UTSW 11 53408409 missense probably damaging 0.99
R7177:Aff4 UTSW 11 53406639 missense probably benign 0.10
R7426:Aff4 UTSW 11 53372875 missense probably damaging 1.00
R7755:Aff4 UTSW 11 53398379 missense probably damaging 0.97
R7848:Aff4 UTSW 11 53404512 missense probably benign 0.05
R7968:Aff4 UTSW 11 53409348 missense probably damaging 1.00
R8159:Aff4 UTSW 11 53411894 missense possibly damaging 0.71
R8218:Aff4 UTSW 11 53398257 missense probably damaging 0.98
R8284:Aff4 UTSW 11 53404552 missense probably damaging 0.99
R8373:Aff4 UTSW 11 53400267 nonsense probably null
R8695:Aff4 UTSW 11 53368682 missense probably damaging 1.00
R8777:Aff4 UTSW 11 53399956 missense probably damaging 1.00
R8777-TAIL:Aff4 UTSW 11 53399956 missense probably damaging 1.00
R8780:Aff4 UTSW 11 53380617 missense probably damaging 1.00
R8798:Aff4 UTSW 11 53400508 critical splice donor site probably benign
R8838:Aff4 UTSW 11 53406638 missense possibly damaging 0.77
R8939:Aff4 UTSW 11 53372404 missense probably benign
R9146:Aff4 UTSW 11 53408136 missense probably benign 0.06
R9329:Aff4 UTSW 11 53397859 missense probably damaging 1.00
R9378:Aff4 UTSW 11 53372479 missense probably damaging 0.98
R9471:Aff4 UTSW 11 53380646 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TCGTGGAGGCCTGAAGATAG -3'
(R):5'- ACAATGAGTGGATACCTGTCATC -3'

Sequencing Primer
(F):5'- AGTGAGACCCCTGTGGACATG -3'
(R):5'- GAGAGAACATTCGTTGCC -3'
Posted On 2020-07-13