Incidental Mutation 'R8241:Vmn2r98'
ID 637577
Institutional Source Beutler Lab
Gene Symbol Vmn2r98
Ensembl Gene ENSMUSG00000096717
Gene Name vomeronasal 2, receptor 98
Synonyms EG224552
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R8241 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 19273755-19301573 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 19301031 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 678 (K678E)
Ref Sequence ENSEMBL: ENSMUSP00000131261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170424]
AlphaFold E9PZ56
Predicted Effect probably damaging
Transcript: ENSMUST00000170424
AA Change: K678E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131261
Gene: ENSMUSG00000096717
AA Change: K678E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 460 2.6e-35 PFAM
Pfam:NCD3G 509 562 7.4e-22 PFAM
Pfam:7tm_3 594 830 1.4e-52 PFAM
low complexity region 844 856 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.1%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,079,456 (GRCm39) R1233G probably null Het
Acacb A T 5: 114,333,297 (GRCm39) I474F possibly damaging Het
Adora1 A T 1: 134,131,062 (GRCm39) V203D probably damaging Het
Aff4 A G 11: 53,290,998 (GRCm39) S653G probably benign Het
Agtr1a T C 13: 30,565,082 (GRCm39) V49A probably damaging Het
Ahnak T C 19: 8,984,659 (GRCm39) V1981A probably benign Het
Arhgap5 T G 12: 52,565,098 (GRCm39) Y690D probably benign Het
Bbs9 A G 9: 22,590,214 (GRCm39) I651V probably benign Het
Brms1 C T 19: 5,096,007 (GRCm39) A27V probably benign Het
Camta1 A G 4: 151,168,282 (GRCm39) V256A probably benign Het
Capg G T 6: 72,533,236 (GRCm39) probably null Het
Chpt1 T C 10: 88,288,953 (GRCm39) K154E Het
Cyp1b1 T C 17: 80,021,223 (GRCm39) E173G probably damaging Het
Fan1 T A 7: 64,022,234 (GRCm39) N340Y probably damaging Het
Fbxw27 T G 9: 109,602,283 (GRCm39) N230T possibly damaging Het
Fer1l4 T C 2: 155,891,585 (GRCm39) T126A probably benign Het
Fut10 C A 8: 31,750,034 (GRCm39) S440* probably null Het
Gbf1 T C 19: 46,234,576 (GRCm39) V71A probably damaging Het
Gpatch8 T C 11: 102,378,347 (GRCm39) E201G unknown Het
Hic2 A G 16: 17,076,950 (GRCm39) Y593C probably damaging Het
Hlcs A T 16: 94,068,677 (GRCm39) V181E probably damaging Het
Itpr2 A T 6: 146,320,013 (GRCm39) I176N possibly damaging Het
Kcna2 G T 3: 107,012,338 (GRCm39) K306N probably damaging Het
Kcnb1 A G 2: 166,948,117 (GRCm39) Y244H probably damaging Het
Klhl8 C T 5: 104,015,392 (GRCm39) V511I probably damaging Het
Mapk14 T A 17: 28,934,374 (GRCm39) D88E possibly damaging Het
Marchf10 C A 11: 105,280,741 (GRCm39) A515S probably benign Het
Mrpl1 T A 5: 96,386,733 (GRCm39) L241I probably damaging Het
Mybpc1 A T 10: 88,372,286 (GRCm39) N781K probably benign Het
Nfkb2 T A 19: 46,296,054 (GRCm39) D186E probably benign Het
Or3a1b G A 11: 74,013,035 (GRCm39) V307I probably benign Het
Plcl1 A G 1: 55,734,976 (GRCm39) I106V probably benign Het
Ppp4r2 A G 6: 100,842,044 (GRCm39) I168M probably damaging Het
Prpf4b A T 13: 35,079,974 (GRCm39) K779N probably damaging Het
Qrich1 T C 9: 108,433,760 (GRCm39) probably null Het
Rgs12 T C 5: 35,123,117 (GRCm39) F300S probably damaging Het
Sart3 T A 5: 113,884,029 (GRCm39) K661M probably benign Het
Scyl2 T C 10: 89,489,971 (GRCm39) I464V possibly damaging Het
Sema5a A G 15: 32,575,064 (GRCm39) T391A probably benign Het
Sh3bgr A G 16: 96,025,070 (GRCm39) T183A unknown Het
Sh3rf3 C T 10: 58,940,242 (GRCm39) P688S probably benign Het
Themis3 T C 17: 66,866,962 (GRCm39) T93A probably benign Het
Thsd7b T A 1: 130,117,688 (GRCm39) S1402T probably damaging Het
Ubr1 A T 2: 120,793,937 (GRCm39) D82E possibly damaging Het
Vmn1r223 T C 13: 23,433,982 (GRCm39) F192S probably benign Het
Vps13d G T 4: 144,875,047 (GRCm39) T1826N Het
Vps41 A G 13: 19,033,168 (GRCm39) D633G possibly damaging Het
Wdr3 A T 3: 100,057,259 (GRCm39) I448N probably damaging Het
Other mutations in Vmn2r98
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r98 APN 17 19,286,007 (GRCm39) splice site probably benign
IGL01296:Vmn2r98 APN 17 19,285,447 (GRCm39) missense probably damaging 1.00
IGL01363:Vmn2r98 APN 17 19,286,020 (GRCm39) missense probably benign 0.01
IGL01618:Vmn2r98 APN 17 19,285,521 (GRCm39) missense possibly damaging 0.93
IGL01746:Vmn2r98 APN 17 19,286,713 (GRCm39) missense probably damaging 1.00
IGL01747:Vmn2r98 APN 17 19,286,702 (GRCm39) missense probably damaging 1.00
IGL01770:Vmn2r98 APN 17 19,286,702 (GRCm39) missense probably damaging 1.00
IGL01868:Vmn2r98 APN 17 19,286,548 (GRCm39) missense probably benign
IGL02123:Vmn2r98 APN 17 19,300,941 (GRCm39) missense probably damaging 1.00
IGL02323:Vmn2r98 APN 17 19,286,113 (GRCm39) missense probably damaging 0.99
IGL02543:Vmn2r98 APN 17 19,286,083 (GRCm39) missense probably benign
IGL02650:Vmn2r98 APN 17 19,301,223 (GRCm39) missense probably benign 0.00
IGL02676:Vmn2r98 APN 17 19,285,521 (GRCm39) missense probably benign 0.00
IGL02803:Vmn2r98 APN 17 19,286,275 (GRCm39) missense probably benign
IGL02807:Vmn2r98 APN 17 19,301,283 (GRCm39) missense probably damaging 1.00
IGL03307:Vmn2r98 APN 17 19,286,242 (GRCm39) missense possibly damaging 0.62
IGL03396:Vmn2r98 APN 17 19,290,107 (GRCm39) missense possibly damaging 0.92
PIT4131001:Vmn2r98 UTSW 17 19,301,223 (GRCm39) missense probably benign 0.00
R0122:Vmn2r98 UTSW 17 19,286,662 (GRCm39) missense probably benign 0.06
R0329:Vmn2r98 UTSW 17 19,286,609 (GRCm39) missense probably benign 0.21
R0330:Vmn2r98 UTSW 17 19,286,609 (GRCm39) missense probably benign 0.21
R0368:Vmn2r98 UTSW 17 19,286,089 (GRCm39) nonsense probably null
R0545:Vmn2r98 UTSW 17 19,273,875 (GRCm39) missense probably benign 0.15
R0635:Vmn2r98 UTSW 17 19,300,759 (GRCm39) missense probably benign 0.00
R0689:Vmn2r98 UTSW 17 19,300,782 (GRCm39) missense possibly damaging 0.83
R1035:Vmn2r98 UTSW 17 19,301,011 (GRCm39) missense possibly damaging 0.90
R1243:Vmn2r98 UTSW 17 19,286,210 (GRCm39) missense possibly damaging 0.52
R1421:Vmn2r98 UTSW 17 19,285,440 (GRCm39) missense probably damaging 1.00
R1629:Vmn2r98 UTSW 17 19,287,645 (GRCm39) missense possibly damaging 0.94
R1643:Vmn2r98 UTSW 17 19,301,170 (GRCm39) missense probably damaging 1.00
R1795:Vmn2r98 UTSW 17 19,286,702 (GRCm39) missense probably damaging 1.00
R1958:Vmn2r98 UTSW 17 19,286,680 (GRCm39) missense possibly damaging 0.70
R1962:Vmn2r98 UTSW 17 19,285,595 (GRCm39) nonsense probably null
R2165:Vmn2r98 UTSW 17 19,301,553 (GRCm39) missense unknown
R2238:Vmn2r98 UTSW 17 19,286,213 (GRCm39) missense probably damaging 1.00
R2252:Vmn2r98 UTSW 17 19,300,698 (GRCm39) missense probably benign 0.00
R2323:Vmn2r98 UTSW 17 19,286,081 (GRCm39) missense probably benign 0.18
R2887:Vmn2r98 UTSW 17 19,301,439 (GRCm39) missense possibly damaging 0.83
R2909:Vmn2r98 UTSW 17 19,287,664 (GRCm39) missense probably damaging 1.00
R3001:Vmn2r98 UTSW 17 19,286,125 (GRCm39) missense probably benign 0.01
R3002:Vmn2r98 UTSW 17 19,286,125 (GRCm39) missense probably benign 0.01
R3003:Vmn2r98 UTSW 17 19,286,125 (GRCm39) missense probably benign 0.01
R3788:Vmn2r98 UTSW 17 19,300,887 (GRCm39) missense probably benign 0.31
R4570:Vmn2r98 UTSW 17 19,286,354 (GRCm39) missense probably benign 0.11
R4706:Vmn2r98 UTSW 17 19,290,007 (GRCm39) missense probably damaging 1.00
R4723:Vmn2r98 UTSW 17 19,286,602 (GRCm39) missense probably benign 0.01
R5036:Vmn2r98 UTSW 17 19,286,419 (GRCm39) missense probably benign 0.00
R5072:Vmn2r98 UTSW 17 19,286,306 (GRCm39) missense probably benign 0.07
R5121:Vmn2r98 UTSW 17 19,273,815 (GRCm39) missense probably benign 0.13
R5283:Vmn2r98 UTSW 17 19,300,981 (GRCm39) missense probably benign 0.05
R5294:Vmn2r98 UTSW 17 19,290,016 (GRCm39) nonsense probably null
R5371:Vmn2r98 UTSW 17 19,290,015 (GRCm39) missense probably damaging 1.00
R5532:Vmn2r98 UTSW 17 19,287,645 (GRCm39) missense possibly damaging 0.94
R5598:Vmn2r98 UTSW 17 19,301,161 (GRCm39) missense probably benign 0.37
R5800:Vmn2r98 UTSW 17 19,286,260 (GRCm39) missense probably benign 0.17
R6089:Vmn2r98 UTSW 17 19,286,336 (GRCm39) missense probably benign 0.29
R6155:Vmn2r98 UTSW 17 19,286,143 (GRCm39) missense possibly damaging 0.87
R6853:Vmn2r98 UTSW 17 19,286,063 (GRCm39) missense probably benign 0.00
R6920:Vmn2r98 UTSW 17 19,285,510 (GRCm39) missense probably damaging 0.98
R7012:Vmn2r98 UTSW 17 19,286,530 (GRCm39) missense probably benign 0.06
R7042:Vmn2r98 UTSW 17 19,301,184 (GRCm39) missense probably benign
R7068:Vmn2r98 UTSW 17 19,285,575 (GRCm39) missense probably benign
R7607:Vmn2r98 UTSW 17 19,287,570 (GRCm39) missense possibly damaging 0.95
R7763:Vmn2r98 UTSW 17 19,300,797 (GRCm39) missense probably benign 0.00
R7771:Vmn2r98 UTSW 17 19,287,460 (GRCm39) splice site probably null
R7915:Vmn2r98 UTSW 17 19,287,493 (GRCm39) missense probably benign 0.10
R8028:Vmn2r98 UTSW 17 19,273,912 (GRCm39) missense probably benign 0.00
R8205:Vmn2r98 UTSW 17 19,301,425 (GRCm39) missense probably damaging 0.99
R8906:Vmn2r98 UTSW 17 19,286,532 (GRCm39) missense probably benign
R8952:Vmn2r98 UTSW 17 19,285,531 (GRCm39) missense possibly damaging 0.76
R9147:Vmn2r98 UTSW 17 19,286,383 (GRCm39) missense probably benign 0.04
R9148:Vmn2r98 UTSW 17 19,286,383 (GRCm39) missense probably benign 0.04
R9187:Vmn2r98 UTSW 17 19,301,481 (GRCm39) missense probably damaging 1.00
R9344:Vmn2r98 UTSW 17 19,286,777 (GRCm39) missense probably benign 0.14
R9467:Vmn2r98 UTSW 17 19,287,517 (GRCm39) missense probably benign 0.01
R9487:Vmn2r98 UTSW 17 19,301,496 (GRCm39) missense possibly damaging 0.78
R9753:Vmn2r98 UTSW 17 19,285,665 (GRCm39) missense probably benign 0.27
Z1177:Vmn2r98 UTSW 17 19,287,685 (GRCm39) nonsense probably null
Z1177:Vmn2r98 UTSW 17 19,285,398 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGCATCTTTGTGAAGCACAG -3'
(R):5'- GCACAAAATGAGGATGTGTCC -3'

Sequencing Primer
(F):5'- TGTGAAGCACAGAGACACTCCTATTG -3'
(R):5'- GTCCATATTCAGTATGAGCATCTTGG -3'
Posted On 2020-07-13