Incidental Mutation 'R8241:Vmn2r98'
ID637577
Institutional Source Beutler Lab
Gene Symbol Vmn2r98
Ensembl Gene ENSMUSG00000096717
Gene Namevomeronasal 2, receptor 98
SynonymsEG224552
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R8241 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location19053460-19082411 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19080769 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 678 (K678E)
Ref Sequence ENSEMBL: ENSMUSP00000131261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170424]
Predicted Effect probably damaging
Transcript: ENSMUST00000170424
AA Change: K678E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131261
Gene: ENSMUSG00000096717
AA Change: K678E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 460 2.6e-35 PFAM
Pfam:NCD3G 509 562 7.4e-22 PFAM
Pfam:7tm_3 594 830 1.4e-52 PFAM
low complexity region 844 856 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.1%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,188,630 R1233G probably null Het
Acacb A T 5: 114,195,236 I474F possibly damaging Het
Adora1 A T 1: 134,203,324 V203D probably damaging Het
Aff4 A G 11: 53,400,171 S653G probably benign Het
Agtr1a T C 13: 30,381,099 V49A probably damaging Het
Ahnak T C 19: 9,007,295 V1981A probably benign Het
Arhgap5 T G 12: 52,518,315 Y690D probably benign Het
Bbs9 A G 9: 22,678,918 I651V probably benign Het
Brms1 C T 19: 5,045,979 A27V probably benign Het
Camta1 A G 4: 151,083,825 V256A probably benign Het
Capg G T 6: 72,556,253 probably null Het
Chpt1 T C 10: 88,453,091 K154E Het
Cyp1b1 T C 17: 79,713,794 E173G probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbxw27 T G 9: 109,773,215 N230T possibly damaging Het
Fer1l4 T C 2: 156,049,665 T126A probably benign Het
Fut10 C A 8: 31,260,006 S440* probably null Het
Gbf1 T C 19: 46,246,137 V71A probably damaging Het
Gpatch8 T C 11: 102,487,521 E201G unknown Het
Hic2 A G 16: 17,259,086 Y593C probably damaging Het
Hlcs A T 16: 94,267,818 V181E probably damaging Het
Itpr2 A T 6: 146,418,515 I176N possibly damaging Het
Kcna2 G T 3: 107,105,022 K306N probably damaging Het
Kcnb1 A G 2: 167,106,197 Y244H probably damaging Het
Klhl8 C T 5: 103,867,526 V511I probably damaging Het
Mapk14 T A 17: 28,715,400 D88E possibly damaging Het
March10 C A 11: 105,389,915 A515S probably benign Het
Mrpl1 T A 5: 96,238,874 L241I probably damaging Het
Mybpc1 A T 10: 88,536,424 N781K probably benign Het
Nfkb2 T A 19: 46,307,615 D186E probably benign Het
Olfr401 G A 11: 74,122,209 V307I probably benign Het
Plcl1 A G 1: 55,695,817 I106V probably benign Het
Ppp4r2 A G 6: 100,865,083 I168M probably damaging Het
Prpf4b A T 13: 34,895,991 K779N probably damaging Het
Qrich1 T C 9: 108,556,561 probably null Het
Rgs12 T C 5: 34,965,773 F300S probably damaging Het
Sart3 T A 5: 113,745,968 K661M probably benign Het
Scyl2 T C 10: 89,654,109 I464V possibly damaging Het
Sema5a A G 15: 32,574,918 T391A probably benign Het
Sh3bgr A G 16: 96,223,870 T183A unknown Het
Sh3rf3 C T 10: 59,104,420 P688S probably benign Het
Themis3 T C 17: 66,559,967 T93A probably benign Het
Thsd7b T A 1: 130,189,951 S1402T probably damaging Het
Ubr1 A T 2: 120,963,456 D82E possibly damaging Het
Vmn1r223 T C 13: 23,249,812 F192S probably benign Het
Vps13d G T 4: 145,148,477 T1826N Het
Vps41 A G 13: 18,848,998 D633G possibly damaging Het
Wdr3 A T 3: 100,149,943 I448N probably damaging Het
Other mutations in Vmn2r98
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r98 APN 17 19065745 splice site probably benign
IGL01296:Vmn2r98 APN 17 19065185 missense probably damaging 1.00
IGL01363:Vmn2r98 APN 17 19065758 missense probably benign 0.01
IGL01618:Vmn2r98 APN 17 19065259 missense possibly damaging 0.93
IGL01746:Vmn2r98 APN 17 19066451 missense probably damaging 1.00
IGL01747:Vmn2r98 APN 17 19066440 missense probably damaging 1.00
IGL01770:Vmn2r98 APN 17 19066440 missense probably damaging 1.00
IGL01868:Vmn2r98 APN 17 19066286 missense probably benign
IGL02123:Vmn2r98 APN 17 19080679 missense probably damaging 1.00
IGL02323:Vmn2r98 APN 17 19065851 missense probably damaging 0.99
IGL02543:Vmn2r98 APN 17 19065821 missense probably benign
IGL02650:Vmn2r98 APN 17 19080961 missense probably benign 0.00
IGL02676:Vmn2r98 APN 17 19065259 missense probably benign 0.00
IGL02803:Vmn2r98 APN 17 19066013 missense probably benign
IGL02807:Vmn2r98 APN 17 19081021 missense probably damaging 1.00
IGL03307:Vmn2r98 APN 17 19065980 missense possibly damaging 0.62
IGL03396:Vmn2r98 APN 17 19069845 missense possibly damaging 0.92
PIT4131001:Vmn2r98 UTSW 17 19080961 missense probably benign 0.00
R0122:Vmn2r98 UTSW 17 19066400 missense probably benign 0.06
R0329:Vmn2r98 UTSW 17 19066347 missense probably benign 0.21
R0330:Vmn2r98 UTSW 17 19066347 missense probably benign 0.21
R0368:Vmn2r98 UTSW 17 19065827 nonsense probably null
R0545:Vmn2r98 UTSW 17 19053613 missense probably benign 0.15
R0635:Vmn2r98 UTSW 17 19080497 missense probably benign 0.00
R0689:Vmn2r98 UTSW 17 19080520 missense possibly damaging 0.83
R1035:Vmn2r98 UTSW 17 19080749 missense possibly damaging 0.90
R1243:Vmn2r98 UTSW 17 19065948 missense possibly damaging 0.52
R1421:Vmn2r98 UTSW 17 19065178 missense probably damaging 1.00
R1629:Vmn2r98 UTSW 17 19067383 missense possibly damaging 0.94
R1643:Vmn2r98 UTSW 17 19080908 missense probably damaging 1.00
R1795:Vmn2r98 UTSW 17 19066440 missense probably damaging 1.00
R1958:Vmn2r98 UTSW 17 19066418 missense possibly damaging 0.70
R1962:Vmn2r98 UTSW 17 19065333 nonsense probably null
R2165:Vmn2r98 UTSW 17 19081291 missense unknown
R2238:Vmn2r98 UTSW 17 19065951 missense probably damaging 1.00
R2252:Vmn2r98 UTSW 17 19080436 missense probably benign 0.00
R2323:Vmn2r98 UTSW 17 19065819 missense probably benign 0.18
R2887:Vmn2r98 UTSW 17 19081177 missense possibly damaging 0.83
R2909:Vmn2r98 UTSW 17 19067402 missense probably damaging 1.00
R3001:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3002:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3003:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3788:Vmn2r98 UTSW 17 19080625 missense probably benign 0.31
R4570:Vmn2r98 UTSW 17 19066092 missense probably benign 0.11
R4706:Vmn2r98 UTSW 17 19069745 missense probably damaging 1.00
R4723:Vmn2r98 UTSW 17 19066340 missense probably benign 0.01
R5036:Vmn2r98 UTSW 17 19066157 missense probably benign 0.00
R5072:Vmn2r98 UTSW 17 19066044 missense probably benign 0.07
R5121:Vmn2r98 UTSW 17 19053553 missense probably benign 0.13
R5283:Vmn2r98 UTSW 17 19080719 missense probably benign 0.05
R5294:Vmn2r98 UTSW 17 19069754 nonsense probably null
R5371:Vmn2r98 UTSW 17 19069753 missense probably damaging 1.00
R5532:Vmn2r98 UTSW 17 19067383 missense possibly damaging 0.94
R5598:Vmn2r98 UTSW 17 19080899 missense probably benign 0.37
R5800:Vmn2r98 UTSW 17 19065998 missense probably benign 0.17
R6089:Vmn2r98 UTSW 17 19066074 missense probably benign 0.29
R6155:Vmn2r98 UTSW 17 19065881 missense possibly damaging 0.87
R6853:Vmn2r98 UTSW 17 19065801 missense probably benign 0.00
R6920:Vmn2r98 UTSW 17 19065248 missense probably damaging 0.98
R7012:Vmn2r98 UTSW 17 19066268 missense probably benign 0.06
R7042:Vmn2r98 UTSW 17 19080922 missense probably benign
R7068:Vmn2r98 UTSW 17 19065313 missense probably benign
R7607:Vmn2r98 UTSW 17 19067308 missense possibly damaging 0.95
R7763:Vmn2r98 UTSW 17 19080535 missense probably benign 0.00
R7771:Vmn2r98 UTSW 17 19067198 splice site probably null
R7915:Vmn2r98 UTSW 17 19067231 missense probably benign 0.10
R8028:Vmn2r98 UTSW 17 19053650 missense probably benign 0.00
R8205:Vmn2r98 UTSW 17 19081163 missense probably damaging 0.99
R8906:Vmn2r98 UTSW 17 19066270 missense probably benign
R8952:Vmn2r98 UTSW 17 19065269 missense possibly damaging 0.76
Z1177:Vmn2r98 UTSW 17 19065136 critical splice acceptor site probably null
Z1177:Vmn2r98 UTSW 17 19067423 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCATCTTTGTGAAGCACAG -3'
(R):5'- GCACAAAATGAGGATGTGTCC -3'

Sequencing Primer
(F):5'- TGTGAAGCACAGAGACACTCCTATTG -3'
(R):5'- GTCCATATTCAGTATGAGCATCTTGG -3'
Posted On2020-07-13