Incidental Mutation 'R8241:Gbf1'
ID637583
Institutional Source Beutler Lab
Gene Symbol Gbf1
Ensembl Gene ENSMUSG00000025224
Gene Namegolgi-specific brefeldin A-resistance factor 1
Synonyms1700083E03Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8241 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location46152509-46286510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46246137 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 71 (V71A)
Ref Sequence ENSEMBL: ENSMUSP00000026254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026254] [ENSMUST00000176992]
Predicted Effect probably damaging
Transcript: ENSMUST00000026254
AA Change: V71A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000026254
Gene: ENSMUSG00000025224
AA Change: V71A

DomainStartEndE-ValueType
low complexity region 270 288 N/A INTRINSIC
Pfam:Sec7_N 400 551 3.4e-29 PFAM
Sec7 696 884 8.55e-91 SMART
low complexity region 1198 1216 N/A INTRINSIC
low complexity region 1281 1296 N/A INTRINSIC
low complexity region 1773 1793 N/A INTRINSIC
low complexity region 1802 1820 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176992
AA Change: V17A

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135062
Gene: ENSMUSG00000025224
AA Change: V17A

DomainStartEndE-ValueType
low complexity region 216 234 N/A INTRINSIC
Pfam:Sec7_N 343 498 1.5e-35 PFAM
Sec7 642 830 8.55e-91 SMART
low complexity region 1144 1162 N/A INTRINSIC
low complexity region 1227 1242 N/A INTRINSIC
low complexity region 1715 1735 N/A INTRINSIC
low complexity region 1744 1762 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.1%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Sec7 domain family. The encoded protein is a guanine nucleotide exchange factor that regulates the recruitment of proteins to membranes by mediating GDP to GTP exchange. The encoded protein is localized to the Golgi apparatus and plays a role in vesicular trafficking by activating ADP ribosylation factor 1. The encoded protein has also been identified as an important host factor for viral replication. Multiple transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,188,630 R1233G probably null Het
Acacb A T 5: 114,195,236 I474F possibly damaging Het
Adora1 A T 1: 134,203,324 V203D probably damaging Het
Aff4 A G 11: 53,400,171 S653G probably benign Het
Agtr1a T C 13: 30,381,099 V49A probably damaging Het
Ahnak T C 19: 9,007,295 V1981A probably benign Het
Arhgap5 T G 12: 52,518,315 Y690D probably benign Het
Bbs9 A G 9: 22,678,918 I651V probably benign Het
Brms1 C T 19: 5,045,979 A27V probably benign Het
Camta1 A G 4: 151,083,825 V256A probably benign Het
Capg G T 6: 72,556,253 probably null Het
Chpt1 T C 10: 88,453,091 K154E Het
Cyp1b1 T C 17: 79,713,794 E173G probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbxw27 T G 9: 109,773,215 N230T possibly damaging Het
Fer1l4 T C 2: 156,049,665 T126A probably benign Het
Fut10 C A 8: 31,260,006 S440* probably null Het
Gpatch8 T C 11: 102,487,521 E201G unknown Het
Hic2 A G 16: 17,259,086 Y593C probably damaging Het
Hlcs A T 16: 94,267,818 V181E probably damaging Het
Itpr2 A T 6: 146,418,515 I176N possibly damaging Het
Kcna2 G T 3: 107,105,022 K306N probably damaging Het
Kcnb1 A G 2: 167,106,197 Y244H probably damaging Het
Klhl8 C T 5: 103,867,526 V511I probably damaging Het
Mapk14 T A 17: 28,715,400 D88E possibly damaging Het
March10 C A 11: 105,389,915 A515S probably benign Het
Mrpl1 T A 5: 96,238,874 L241I probably damaging Het
Mybpc1 A T 10: 88,536,424 N781K probably benign Het
Nfkb2 T A 19: 46,307,615 D186E probably benign Het
Olfr401 G A 11: 74,122,209 V307I probably benign Het
Plcl1 A G 1: 55,695,817 I106V probably benign Het
Ppp4r2 A G 6: 100,865,083 I168M probably damaging Het
Prpf4b A T 13: 34,895,991 K779N probably damaging Het
Qrich1 T C 9: 108,556,561 probably null Het
Rgs12 T C 5: 34,965,773 F300S probably damaging Het
Sart3 T A 5: 113,745,968 K661M probably benign Het
Scyl2 T C 10: 89,654,109 I464V possibly damaging Het
Sema5a A G 15: 32,574,918 T391A probably benign Het
Sh3bgr A G 16: 96,223,870 T183A unknown Het
Sh3rf3 C T 10: 59,104,420 P688S probably benign Het
Themis3 T C 17: 66,559,967 T93A probably benign Het
Thsd7b T A 1: 130,189,951 S1402T probably damaging Het
Ubr1 A T 2: 120,963,456 D82E possibly damaging Het
Vmn1r223 T C 13: 23,249,812 F192S probably benign Het
Vmn2r98 A G 17: 19,080,769 K678E probably damaging Het
Vps13d G T 4: 145,148,477 T1826N Het
Vps41 A G 13: 18,848,998 D633G possibly damaging Het
Wdr3 A T 3: 100,149,943 I448N probably damaging Het
Other mutations in Gbf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Gbf1 APN 19 46284249 critical splice acceptor site probably null
IGL00988:Gbf1 APN 19 46284120 critical splice donor site probably null
IGL01352:Gbf1 APN 19 46265215 missense probably damaging 1.00
IGL01432:Gbf1 APN 19 46279995 missense probably damaging 1.00
IGL01469:Gbf1 APN 19 46279364 missense probably damaging 1.00
IGL01870:Gbf1 APN 19 46285669 missense probably benign 0.00
IGL02019:Gbf1 APN 19 46279292 missense possibly damaging 0.93
IGL02061:Gbf1 APN 19 46279258 missense possibly damaging 0.65
IGL02126:Gbf1 APN 19 46252117 missense probably damaging 0.97
IGL02272:Gbf1 APN 19 46269803 missense probably damaging 1.00
IGL02346:Gbf1 APN 19 46285930 missense probably damaging 1.00
IGL02491:Gbf1 APN 19 46262540 unclassified probably benign
IGL03003:Gbf1 APN 19 46255655 missense probably damaging 1.00
IGL03130:Gbf1 APN 19 46267348 missense possibly damaging 0.82
IGL03376:Gbf1 APN 19 46262521 missense possibly damaging 0.94
PIT4651001:Gbf1 UTSW 19 46163543 missense probably benign
R0107:Gbf1 UTSW 19 46284828 missense probably benign
R0139:Gbf1 UTSW 19 46261792 missense probably damaging 1.00
R0180:Gbf1 UTSW 19 46285722 missense probably benign
R0255:Gbf1 UTSW 19 46254110 splice site probably benign
R0317:Gbf1 UTSW 19 46254020 missense probably benign
R0329:Gbf1 UTSW 19 46272270 critical splice donor site probably null
R0372:Gbf1 UTSW 19 46285704 missense probably benign
R0666:Gbf1 UTSW 19 46262544 unclassified probably benign
R1463:Gbf1 UTSW 19 46271545 unclassified probably benign
R1701:Gbf1 UTSW 19 46261675 missense probably damaging 1.00
R1848:Gbf1 UTSW 19 46272037 missense possibly damaging 0.90
R1962:Gbf1 UTSW 19 46267219 missense probably damaging 1.00
R1965:Gbf1 UTSW 19 46271564 missense probably damaging 1.00
R1966:Gbf1 UTSW 19 46271564 missense probably damaging 1.00
R2177:Gbf1 UTSW 19 46265670 missense probably benign
R2238:Gbf1 UTSW 19 46163618 missense probably benign
R2239:Gbf1 UTSW 19 46163618 missense probably benign
R2520:Gbf1 UTSW 19 46265367 missense probably benign
R3821:Gbf1 UTSW 19 46264807 missense probably damaging 0.99
R4681:Gbf1 UTSW 19 46280550 missense probably benign 0.41
R4695:Gbf1 UTSW 19 46259167 nonsense probably null
R4785:Gbf1 UTSW 19 46268395 missense possibly damaging 0.89
R5202:Gbf1 UTSW 19 46268454 missense probably benign 0.13
R5359:Gbf1 UTSW 19 46283725 critical splice donor site probably null
R5468:Gbf1 UTSW 19 46284296 missense possibly damaging 0.92
R5593:Gbf1 UTSW 19 46272524 missense possibly damaging 0.91
R5595:Gbf1 UTSW 19 46284422 missense possibly damaging 0.74
R5796:Gbf1 UTSW 19 46284343 missense probably benign 0.08
R5938:Gbf1 UTSW 19 46268452 missense probably damaging 1.00
R5957:Gbf1 UTSW 19 46246221 critical splice donor site probably null
R6059:Gbf1 UTSW 19 46265248 missense probably damaging 1.00
R6120:Gbf1 UTSW 19 46279321 missense possibly damaging 0.83
R6239:Gbf1 UTSW 19 46259696 missense probably benign 0.00
R6252:Gbf1 UTSW 19 46271556 missense probably benign 0.33
R6310:Gbf1 UTSW 19 46280005 missense probably damaging 0.96
R6787:Gbf1 UTSW 19 46271772 missense probably benign
R6805:Gbf1 UTSW 19 46262507 missense probably damaging 1.00
R6855:Gbf1 UTSW 19 46279941 missense probably benign 0.00
R7313:Gbf1 UTSW 19 46280354 missense possibly damaging 0.94
R7414:Gbf1 UTSW 19 46283358 nonsense probably null
R7646:Gbf1 UTSW 19 46283672 missense probably damaging 1.00
R7650:Gbf1 UTSW 19 46272539 missense probably damaging 1.00
R7789:Gbf1 UTSW 19 46254002 missense probably damaging 1.00
R7801:Gbf1 UTSW 19 46272643 missense probably benign 0.03
Z1177:Gbf1 UTSW 19 46259142 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAAGGAGCCCTCTAACTTCATTC -3'
(R):5'- GAGTCCCAGGCAATCTTCTC -3'

Sequencing Primer
(F):5'- GGAGCCCTCTAACTTCATTCAACAG -3'
(R):5'- CCTATGTCTCTACTAGGAAAGGGAC -3'
Posted On2020-07-13