Incidental Mutation 'R8242:Defb22'
ID637591
Institutional Source Beutler Lab
Gene Symbol Defb22
Ensembl Gene ENSMUSG00000027468
Gene Namedefensin beta 22
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8242 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location152485663-152490138 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 152486087 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tryptophan at position 59 (C59W)
Ref Sequence ENSEMBL: ENSMUSP00000028966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028966]
Predicted Effect probably damaging
Transcript: ENSMUST00000028966
AA Change: C59W

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028966
Gene: ENSMUSG00000027468
AA Change: C59W

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Defensin_beta_2 26 59 4e-11 PFAM
low complexity region 89 150 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.2%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932411E22Rik C G 11: 89,526,445 probably null Het
Adcy10 T C 1: 165,546,549 Y736H possibly damaging Het
Akr1c12 G A 13: 4,272,270 R258* probably null Het
Arfgef3 T C 10: 18,630,076 K947E probably benign Het
Barx2 C A 9: 31,912,931 R54L probably damaging Het
BC030500 T C 8: 58,912,354 I13T unknown Het
Bcl11a T A 11: 24,163,208 F184I probably benign Het
Cfap43 A G 19: 47,897,369 L269P probably damaging Het
Col8a1 G T 16: 57,632,358 P94Q possibly damaging Het
Coq5 T C 5: 115,279,747 V12A probably benign Het
Csmd1 A G 8: 16,710,654 V155A probably benign Het
Dsg3 A G 18: 20,536,923 T665A possibly damaging Het
E430025E21Rik A G 15: 59,344,122 S803P probably damaging Het
Gm10542 A G 18: 44,204,641 D62G possibly damaging Het
Gm14025 G T 2: 129,039,393 C204* probably null Het
Gm5591 T A 7: 38,520,322 T376S probably benign Het
Hps3 C T 3: 20,014,126 R588H possibly damaging Het
Itpr1 A T 6: 108,386,697 D760V probably benign Het
Mfsd8 G A 3: 40,835,193 R140C probably damaging Het
Mroh2b A T 15: 4,909,040 R270S probably benign Het
Mroh4 G T 15: 74,616,308 H350N possibly damaging Het
Olfr1055 A T 2: 86,347,082 M228K probably damaging Het
Olfr1178 A G 2: 88,392,074 I276V possibly damaging Het
Olfr525 T A 7: 140,322,783 L28* probably null Het
Olfr560 T C 7: 102,753,099 M277V probably benign Het
Pex5l T A 3: 33,006,035 T196S probably benign Het
Phlpp2 T C 8: 109,940,202 V1121A probably benign Het
Rab3gap2 T A 1: 185,221,853 S41T probably benign Het
Rad51c A T 11: 87,389,886 N293K probably damaging Het
Rgs3 C A 4: 62,619,785 Q18K probably benign Het
Ripk2 C T 4: 16,124,430 G426D probably benign Het
RP23-202K1.1 G A 8: 27,548,793 S987N unknown Het
Rpl22l1 T C 3: 28,806,765 V44A possibly damaging Het
Sntb1 C T 15: 55,792,233 A196T possibly damaging Het
Sorcs3 C T 19: 48,206,474 R99W possibly damaging Het
Tdrd6 T C 17: 43,628,930 E409G probably damaging Het
Timm50 A T 7: 28,308,411 D105E probably benign Het
Tsga10 A T 1: 37,807,101 S315T probably benign Het
Ttpa G A 4: 20,028,511 C256Y probably damaging Het
Vmn2r13 T C 5: 109,175,006 Y139C possibly damaging Het
Wdr66 T A 5: 123,273,851 D515E possibly damaging Het
Whsc1l1 G T 8: 25,706,539 E1183* probably null Het
Zfp985 A C 4: 147,584,182 K502N possibly damaging Het
Other mutations in Defb22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01557:Defb22 APN 2 152486079 missense possibly damaging 0.93
IGL02040:Defb22 APN 2 152490056 missense possibly damaging 0.83
IGL03159:Defb22 APN 2 152490075 missense probably benign 0.00
R5153:Defb22 UTSW 2 152485802 missense unknown
R5387:Defb22 UTSW 2 152485906 missense unknown
R6141:Defb22 UTSW 2 152485802 missense unknown
R7153:Defb22 UTSW 2 152485920 missense unknown
R7385:Defb22 UTSW 2 152486197 missense probably damaging 0.99
R7650:Defb22 UTSW 2 152486103 missense probably benign 0.40
R7671:Defb22 UTSW 2 152486030 missense unknown
R8271:Defb22 UTSW 2 152485792 missense unknown
RF013:Defb22 UTSW 2 152485831 small insertion probably benign
RF021:Defb22 UTSW 2 152485832 small insertion probably benign
RF025:Defb22 UTSW 2 152485823 small insertion probably benign
RF025:Defb22 UTSW 2 152485824 small insertion probably benign
RF029:Defb22 UTSW 2 152485833 small insertion probably benign
RF034:Defb22 UTSW 2 152485832 small insertion probably benign
RF041:Defb22 UTSW 2 152485823 small insertion probably benign
RF043:Defb22 UTSW 2 152485833 small insertion probably benign
RF062:Defb22 UTSW 2 152485825 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GGTATTGCCAGCCATTGTGG -3'
(R):5'- TGGCATGGTTTCAGCTATCTGC -3'

Sequencing Primer
(F):5'- CATTGTGGCAGCGCTGG -3'
(R):5'- GCTATCTGCTCAGTACCTGGG -3'
Posted On2020-07-13