Incidental Mutation 'R8242:Phlpp2'
ID637612
Institutional Source Beutler Lab
Gene Symbol Phlpp2
Ensembl Gene ENSMUSG00000031732
Gene NamePH domain and leucine rich repeat protein phosphatase 2
SynonymsC130044A18Rik, Phlppl
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R8242 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location109868542-109944671 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109940202 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1121 (V1121A)
Ref Sequence ENSEMBL: ENSMUSP00000136166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034175] [ENSMUST00000179721]
Predicted Effect probably benign
Transcript: ENSMUST00000034175
AA Change: V1086A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000034175
Gene: ENSMUSG00000031732
AA Change: V1086A

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Blast:PH 148 247 3e-61 BLAST
LRR 295 314 1.12e2 SMART
Pfam:LRR_7 319 335 3.5e-2 PFAM
LRR 341 363 2.82e0 SMART
LRR 364 387 9.75e0 SMART
LRR 456 479 2.68e1 SMART
LRR 498 517 1.35e1 SMART
LRR 521 540 5.59e1 SMART
LRR 544 563 2.79e1 SMART
LRR 569 589 1.62e1 SMART
LRR 590 609 1.67e1 SMART
LRR 616 641 1.33e2 SMART
LRR 640 659 1.4e1 SMART
LRR_TYP 664 687 6.78e-3 SMART
LRR 709 733 2.15e2 SMART
PP2Cc 772 1028 2.98e-30 SMART
low complexity region 1061 1095 N/A INTRINSIC
Blast:PP2Cc 1109 1175 8e-15 BLAST
low complexity region 1297 1315 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179721
AA Change: V1121A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000136166
Gene: ENSMUSG00000031732
AA Change: V1121A

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 75 92 N/A INTRINSIC
Blast:PH 183 282 4e-61 BLAST
LRR 330 349 1.12e2 SMART
LRR 376 398 2.82e0 SMART
LRR 399 422 9.75e0 SMART
LRR 491 514 2.68e1 SMART
LRR 533 552 1.35e1 SMART
LRR 556 575 5.59e1 SMART
LRR 579 598 2.79e1 SMART
LRR 604 624 1.62e1 SMART
LRR 625 644 1.67e1 SMART
LRR 651 676 1.33e2 SMART
LRR 675 694 1.4e1 SMART
LRR_TYP 699 722 6.78e-3 SMART
LRR 744 768 2.15e2 SMART
PP2Cc 807 1063 2.98e-30 SMART
low complexity region 1096 1130 N/A INTRINSIC
Blast:PP2Cc 1144 1210 8e-15 BLAST
low complexity region 1332 1350 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.2%
Validation Efficiency 98% (42/43)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal susceptibility to DSS-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932411E22Rik C G 11: 89,526,445 probably null Het
Adcy10 T C 1: 165,546,549 Y736H possibly damaging Het
Akr1c12 G A 13: 4,272,270 R258* probably null Het
Arfgef3 T C 10: 18,630,076 K947E probably benign Het
Barx2 C A 9: 31,912,931 R54L probably damaging Het
BC030500 T C 8: 58,912,354 I13T unknown Het
Bcl11a T A 11: 24,163,208 F184I probably benign Het
Cfap43 A G 19: 47,897,369 L269P probably damaging Het
Col8a1 G T 16: 57,632,358 P94Q possibly damaging Het
Coq5 T C 5: 115,279,747 V12A probably benign Het
Csmd1 A G 8: 16,710,654 V155A probably benign Het
Defb22 A C 2: 152,486,087 C59W probably damaging Het
Dsg3 A G 18: 20,536,923 T665A possibly damaging Het
E430025E21Rik A G 15: 59,344,122 S803P probably damaging Het
Gm10542 A G 18: 44,204,641 D62G possibly damaging Het
Gm14025 G T 2: 129,039,393 C204* probably null Het
Gm5591 T A 7: 38,520,322 T376S probably benign Het
Hps3 C T 3: 20,014,126 R588H possibly damaging Het
Itpr1 A T 6: 108,386,697 D760V probably benign Het
Mfsd8 G A 3: 40,835,193 R140C probably damaging Het
Mroh2b A T 15: 4,909,040 R270S probably benign Het
Mroh4 G T 15: 74,616,308 H350N possibly damaging Het
Olfr1055 A T 2: 86,347,082 M228K probably damaging Het
Olfr1178 A G 2: 88,392,074 I276V possibly damaging Het
Olfr525 T A 7: 140,322,783 L28* probably null Het
Olfr560 T C 7: 102,753,099 M277V probably benign Het
Pex5l T A 3: 33,006,035 T196S probably benign Het
Rab3gap2 T A 1: 185,221,853 S41T probably benign Het
Rad51c A T 11: 87,389,886 N293K probably damaging Het
Rgs3 C A 4: 62,619,785 Q18K probably benign Het
Ripk2 C T 4: 16,124,430 G426D probably benign Het
RP23-202K1.1 G A 8: 27,548,793 S987N unknown Het
Rpl22l1 T C 3: 28,806,765 V44A possibly damaging Het
Sntb1 C T 15: 55,792,233 A196T possibly damaging Het
Sorcs3 C T 19: 48,206,474 R99W possibly damaging Het
Tdrd6 T C 17: 43,628,930 E409G probably damaging Het
Timm50 A T 7: 28,308,411 D105E probably benign Het
Tsga10 A T 1: 37,807,101 S315T probably benign Het
Ttpa G A 4: 20,028,511 C256Y probably damaging Het
Vmn2r13 T C 5: 109,175,006 Y139C possibly damaging Het
Wdr66 T A 5: 123,273,851 D515E possibly damaging Het
Whsc1l1 G T 8: 25,706,539 E1183* probably null Het
Zfp985 A C 4: 147,584,182 K502N possibly damaging Het
Other mutations in Phlpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Phlpp2 APN 8 109925790 missense probably benign 0.01
IGL01363:Phlpp2 APN 8 109937097 missense probably benign 0.22
IGL01535:Phlpp2 APN 8 109934065 missense possibly damaging 0.82
IGL01815:Phlpp2 APN 8 109939859 missense probably benign
IGL02105:Phlpp2 APN 8 109904408 missense probably damaging 1.00
IGL02257:Phlpp2 APN 8 109920099 missense possibly damaging 0.88
IGL02318:Phlpp2 APN 8 109939873 missense probably benign 0.04
IGL02500:Phlpp2 APN 8 109913618 missense probably benign
IGL03356:Phlpp2 APN 8 109935617 missense probably benign 0.00
IGL03366:Phlpp2 APN 8 109940835 missense probably benign 0.44
R0142:Phlpp2 UTSW 8 109907513 missense probably damaging 1.00
R0144:Phlpp2 UTSW 8 109907513 missense probably damaging 1.00
R0374:Phlpp2 UTSW 8 109907513 missense probably damaging 1.00
R0420:Phlpp2 UTSW 8 109939935 missense probably damaging 0.99
R0426:Phlpp2 UTSW 8 109928463 missense probably benign 0.01
R0477:Phlpp2 UTSW 8 109895506 critical splice acceptor site probably null
R0529:Phlpp2 UTSW 8 109876971 missense probably benign 0.00
R0605:Phlpp2 UTSW 8 109933211 missense probably benign 0.00
R0655:Phlpp2 UTSW 8 109895587 missense probably benign 0.00
R0833:Phlpp2 UTSW 8 109937106 missense probably damaging 1.00
R0836:Phlpp2 UTSW 8 109937106 missense probably damaging 1.00
R1394:Phlpp2 UTSW 8 109877030 nonsense probably null
R1417:Phlpp2 UTSW 8 109940681 nonsense probably null
R1602:Phlpp2 UTSW 8 109934023 missense possibly damaging 0.96
R1650:Phlpp2 UTSW 8 109933955 splice site probably benign
R1815:Phlpp2 UTSW 8 109940223 missense probably damaging 1.00
R2045:Phlpp2 UTSW 8 109907600 missense probably damaging 1.00
R2072:Phlpp2 UTSW 8 109928492 missense possibly damaging 0.88
R2074:Phlpp2 UTSW 8 109928492 missense possibly damaging 0.88
R2075:Phlpp2 UTSW 8 109928492 missense possibly damaging 0.88
R2433:Phlpp2 UTSW 8 109940002 missense probably damaging 1.00
R3028:Phlpp2 UTSW 8 109907613 missense probably damaging 1.00
R4611:Phlpp2 UTSW 8 109876883 missense possibly damaging 0.79
R4718:Phlpp2 UTSW 8 109940820 missense probably benign 0.31
R4739:Phlpp2 UTSW 8 109940420 missense probably damaging 1.00
R4857:Phlpp2 UTSW 8 109877010 missense probably damaging 1.00
R5020:Phlpp2 UTSW 8 109940082 missense probably damaging 1.00
R5047:Phlpp2 UTSW 8 109913619 missense probably benign 0.04
R5074:Phlpp2 UTSW 8 109925829 missense probably damaging 0.99
R5330:Phlpp2 UTSW 8 109934035 missense probably damaging 0.99
R5663:Phlpp2 UTSW 8 109904344 missense probably benign 0.01
R5668:Phlpp2 UTSW 8 109928573 missense possibly damaging 0.67
R6433:Phlpp2 UTSW 8 109934685 missense probably benign
R6470:Phlpp2 UTSW 8 109937194 missense probably benign 0.45
R6804:Phlpp2 UTSW 8 109928565 missense probably damaging 1.00
R7012:Phlpp2 UTSW 8 109876854 missense possibly damaging 0.95
R7183:Phlpp2 UTSW 8 109939953 missense probably damaging 1.00
R7257:Phlpp2 UTSW 8 109940188 missense probably benign
R7312:Phlpp2 UTSW 8 109940153 missense probably damaging 0.96
R7349:Phlpp2 UTSW 8 109928646 missense probably damaging 0.98
R7801:Phlpp2 UTSW 8 109925842 missense possibly damaging 0.56
R8059:Phlpp2 UTSW 8 109895557 missense probably benign 0.00
R8174:Phlpp2 UTSW 8 109868689 missense unknown
X0018:Phlpp2 UTSW 8 109912369 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGTGCACATTAGCCCAG -3'
(R):5'- CCATTGTCAGACTGATTGCTG -3'

Sequencing Primer
(F):5'- CAGAGCTACGGTTGTCAGGAC -3'
(R):5'- TTGTCAGACTGATTGCTGGAAAAAG -3'
Posted On2020-07-13