Mutagenetix > Incidental Mutation

Incidental Mutation 'R8243:Olfr1216'

637633

Institutional Source

Beutler Lab

Gene Symbol

Olfr1216

Ensembl Gene

ENSMUSG00000075107

Gene Name

olfactory receptor 1216

Synonyms

GA_x6K02T2Q125-50494588-50493653, MOR233-9

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.052) question?

Stock #

R8243 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

89007563-89018340 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 89013707 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 119 (Y119F)

Ref Sequence

ENSEMBL: ENSMUSP00000097388 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099800]

AlphaFold

Q7TR05

Predicted Effect

probably benign
Transcript: ENSMUST00000099800
AA Change: Y119F

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000097388
Gene: ENSMUSG00000075107
AA Change: Y119F

Domain	Start	End	E-Value	Type
Pfam:7tm_4	29	303	1.8e-46	PFAM
Pfam:7tm_1	39	286	4.2e-17	PFAM

Coding Region Coverage

1x: 99.8%
3x: 99.5%
10x: 98.7%
20x: 96.0%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam19	T	A	11: 46,125,082	H356Q	probably damaging	Het
BC030500	T	C	8: 58,912,354	I13T	unknown	Het
Bcl6	C	T	16: 23,968,133	C636Y	probably damaging	Het
Cabyr	G	T	18: 12,750,702	C82F	probably benign	Het
Clec4a1	T	C	6: 122,924,819	V70A	possibly damaging	Het
Col11a1	C	T	3: 114,061,492	P134S	unknown	Het
Col27a1	A	G	4: 63,225,883	T603A	probably damaging	Het
Col6a6	T	C	9: 105,699,269	D1964G	probably damaging	Het
Diexf	T	C	1: 193,114,629	D598G	probably benign	Het
Dnajc8	A	G	4: 132,551,464		probably null	Het
E330034G19Rik	T	C	14: 24,308,292	Y318H		Het
Efemp1	T	A	11: 28,921,690	S402T	probably damaging	Het
Emcn	T	C	3: 137,391,650	V110A	possibly damaging	Het
Fgd5	C	T	6: 91,989,023	L746F	possibly damaging	Het
Gna13	A	G	11: 109,396,413	N354S	probably damaging	Het
Helq	G	T	5: 100,770,482	S855R	possibly damaging	Het
Hps5	G	T	7: 46,786,642	A160E	probably damaging	Het
Igfbp7	T	A	5: 77,401,492	E188V	probably benign	Het
Ivd	A	G	2: 118,871,537	Y150C	probably damaging	Het
Jade2	T	C	11: 51,817,218	T723A	probably benign	Het
Kif1b	T	C	4: 149,204,267	N1239S	probably benign	Het
Klb	A	G	5: 65,378,995	N556S	possibly damaging	Het
Klhdc8a	C	T	1: 132,302,566	R140C	possibly damaging	Het
Klhl2	T	A	8: 64,749,050	M531L	probably benign	Het
Mark3	T	A	12: 111,647,522	S546R	possibly damaging	Het
Mfsd8	G	A	3: 40,835,193	R140C	probably damaging	Het
Musk	G	A	4: 58,293,600	R63K	probably benign	Het
Nacad	C	T	11: 6,602,643	E183K	probably damaging	Het
Oasl1	T	C	5: 114,928,161	Y113H	probably benign	Het
Olfr54	C	T	11: 51,027,311	T103M	probably benign	Het
Olfr613	A	T	7: 103,551,998	D71V	probably damaging	Het
Olfr923	A	G	9: 38,828,507	E272G		Het
Olfr980	A	T	9: 40,006,188	C254S	probably benign	Het
P4hb	T	C	11: 120,563,380	D296G	probably benign	Het
Plat	G	T	8: 22,772,232	G91W	probably damaging	Het
Plekhh1	G	A	12: 79,079,069	R1293H	probably benign	Het
Prss21	A	G	17: 23,869,402	T114A	probably damaging	Het
Ptprn	T	C	1: 75,252,535	D776G	probably damaging	Het
Rffl	A	G	11: 82,812,795	C101R	probably damaging	Het
Rundc1	A	G	11: 101,425,558	D152G	probably benign	Het
Sema6c	A	G	3: 95,172,605	T737A	probably damaging	Het
Sppl2c	A	G	11: 104,187,861	T496A	probably damaging	Het
Supt7l	T	C	5: 31,515,669	I412V	probably benign	Het
Trim38	T	A	13: 23,791,395	I439N	probably damaging	Het
Ugt1a1	CAGAGAGAGAGAGA	CAGAGAGAGAGA	1: 88,211,984		probably benign	Het
Usp18	G	A	6: 121,269,144	R353H	probably benign	Het
Usp42	T	C	5: 143,715,094	K1058R	probably benign	Het

Other mutations in Olfr1216

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Olfr1216	APN	2	89013924	missense	probably benign	0.22
IGL00895:Olfr1216	APN	2	89013609	missense	probably benign	0.13
IGL01634:Olfr1216	APN	2	89013444	missense	probably damaging	0.99
IGL01844:Olfr1216	APN	2	89013470	missense	possibly damaging	0.95
IGL02036:Olfr1216	APN	2	89013479	missense	probably benign	0.00
IGL02102:Olfr1216	APN	2	89013126	utr 3 prime	probably benign
IGL02194:Olfr1216	APN	2	89013887	missense	probably damaging	1.00
IGL02483:Olfr1216	APN	2	89013203	missense	probably damaging	1.00
IGL02745:Olfr1216	APN	2	89013888	missense	probably damaging	1.00
IGL02829:Olfr1216	APN	2	89013677	missense	probably damaging	1.00
IGL03113:Olfr1216	APN	2	89014035	missense	probably damaging	1.00
IGL03324:Olfr1216	APN	2	89013559	nonsense	probably null
R0102:Olfr1216	UTSW	2	89013671	missense	probably damaging	1.00
R0304:Olfr1216	UTSW	2	89013288	missense	probably damaging	1.00
R1184:Olfr1216	UTSW	2	89013713	missense	probably damaging	0.99
R1484:Olfr1216	UTSW	2	89013369	nonsense	probably null
R1560:Olfr1216	UTSW	2	89013206	missense	probably damaging	1.00
R1823:Olfr1216	UTSW	2	89013378	missense	probably benign	0.02
R1911:Olfr1216	UTSW	2	89013221	missense	probably damaging	1.00
R2245:Olfr1216	UTSW	2	89013149	missense	probably benign
R2331:Olfr1216	UTSW	2	89013921	missense	probably benign
R3859:Olfr1216	UTSW	2	89014061	start codon destroyed	probably null	1.00
R4579:Olfr1216	UTSW	2	89013144	missense	probably benign
R5022:Olfr1216	UTSW	2	89014043	missense	probably damaging	0.96
R5353:Olfr1216	UTSW	2	89013755	missense	probably benign	0.00
R5894:Olfr1216	UTSW	2	89014055	missense	probably damaging	1.00
R6240:Olfr1216	UTSW	2	89013626	missense	probably benign	0.03
R7101:Olfr1216	UTSW	2	89013980	missense	possibly damaging	0.90
R7652:Olfr1216	UTSW	2	89013549	missense	probably benign	0.01
R8752:Olfr1216	UTSW	2	89013887	missense	probably damaging	1.00
R9062:Olfr1216	UTSW	2	89013204	missense	probably damaging	1.00
R9472:Olfr1216	UTSW	2	89013173	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- GCCAGCTTCAGCAATGGAAAC -3'
(R):5'- ATCATCTACAGCCCTGCACTG -3'

Sequencing Primer
(F):5'- GCTTCAGCAATGGAAACAAGTC -3'
(R):5'- GCTGAGCTCCCCCATGTAC -3'

Posted On

2020-07-13