Incidental Mutation 'R8243:Olfr1216'
ID637633
Institutional Source Beutler Lab
Gene Symbol Olfr1216
Ensembl Gene ENSMUSG00000075107
Gene Nameolfactory receptor 1216
SynonymsGA_x6K02T2Q125-50494588-50493653, MOR233-9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R8243 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location89007563-89018340 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89013707 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 119 (Y119F)
Ref Sequence ENSEMBL: ENSMUSP00000097388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099800]
Predicted Effect probably benign
Transcript: ENSMUST00000099800
AA Change: Y119F

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097388
Gene: ENSMUSG00000075107
AA Change: Y119F

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.8e-46 PFAM
Pfam:7tm_1 39 286 4.2e-17 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.7%
  • 20x: 96.0%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T A 11: 46,125,082 H356Q probably damaging Het
BC030500 T C 8: 58,912,354 I13T unknown Het
Bcl6 C T 16: 23,968,133 C636Y probably damaging Het
Cabyr G T 18: 12,750,702 C82F probably benign Het
Clec4a1 T C 6: 122,924,819 V70A possibly damaging Het
Col11a1 C T 3: 114,061,492 P134S unknown Het
Col27a1 A G 4: 63,225,883 T603A probably damaging Het
Col6a6 T C 9: 105,699,269 D1964G probably damaging Het
Diexf T C 1: 193,114,629 D598G probably benign Het
Dnajc8 A G 4: 132,551,464 probably null Het
E330034G19Rik T C 14: 24,308,292 Y318H Het
Efemp1 T A 11: 28,921,690 S402T probably damaging Het
Emcn T C 3: 137,391,650 V110A possibly damaging Het
Fgd5 C T 6: 91,989,023 L746F possibly damaging Het
Gna13 A G 11: 109,396,413 N354S probably damaging Het
Helq G T 5: 100,770,482 S855R possibly damaging Het
Hps5 G T 7: 46,786,642 A160E probably damaging Het
Igfbp7 T A 5: 77,401,492 E188V probably benign Het
Ivd A G 2: 118,871,537 Y150C probably damaging Het
Jade2 T C 11: 51,817,218 T723A probably benign Het
Kif1b T C 4: 149,204,267 N1239S probably benign Het
Klb A G 5: 65,378,995 N556S possibly damaging Het
Klhdc8a C T 1: 132,302,566 R140C possibly damaging Het
Klhl2 T A 8: 64,749,050 M531L probably benign Het
Mark3 T A 12: 111,647,522 S546R possibly damaging Het
Mfsd8 G A 3: 40,835,193 R140C probably damaging Het
Musk G A 4: 58,293,600 R63K probably benign Het
Nacad C T 11: 6,602,643 E183K probably damaging Het
Oasl1 T C 5: 114,928,161 Y113H probably benign Het
Olfr54 C T 11: 51,027,311 T103M probably benign Het
Olfr613 A T 7: 103,551,998 D71V probably damaging Het
Olfr923 A G 9: 38,828,507 E272G Het
Olfr980 A T 9: 40,006,188 C254S probably benign Het
P4hb T C 11: 120,563,380 D296G probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plekhh1 G A 12: 79,079,069 R1293H probably benign Het
Prss21 A G 17: 23,869,402 T114A probably damaging Het
Ptprn T C 1: 75,252,535 D776G probably damaging Het
Rffl A G 11: 82,812,795 C101R probably damaging Het
Rundc1 A G 11: 101,425,558 D152G probably benign Het
Sema6c A G 3: 95,172,605 T737A probably damaging Het
Sppl2c A G 11: 104,187,861 T496A probably damaging Het
Supt7l T C 5: 31,515,669 I412V probably benign Het
Trim38 T A 13: 23,791,395 I439N probably damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Usp18 G A 6: 121,269,144 R353H probably benign Het
Usp42 T C 5: 143,715,094 K1058R probably benign Het
Other mutations in Olfr1216
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Olfr1216 APN 2 89013924 missense probably benign 0.22
IGL00895:Olfr1216 APN 2 89013609 missense probably benign 0.13
IGL01634:Olfr1216 APN 2 89013444 missense probably damaging 0.99
IGL01844:Olfr1216 APN 2 89013470 missense possibly damaging 0.95
IGL02036:Olfr1216 APN 2 89013479 missense probably benign 0.00
IGL02102:Olfr1216 APN 2 89013126 utr 3 prime probably benign
IGL02194:Olfr1216 APN 2 89013887 missense probably damaging 1.00
IGL02483:Olfr1216 APN 2 89013203 missense probably damaging 1.00
IGL02745:Olfr1216 APN 2 89013888 missense probably damaging 1.00
IGL02829:Olfr1216 APN 2 89013677 missense probably damaging 1.00
IGL03113:Olfr1216 APN 2 89014035 missense probably damaging 1.00
IGL03324:Olfr1216 APN 2 89013559 nonsense probably null
R0102:Olfr1216 UTSW 2 89013671 missense probably damaging 1.00
R0304:Olfr1216 UTSW 2 89013288 missense probably damaging 1.00
R1184:Olfr1216 UTSW 2 89013713 missense probably damaging 0.99
R1484:Olfr1216 UTSW 2 89013369 nonsense probably null
R1560:Olfr1216 UTSW 2 89013206 missense probably damaging 1.00
R1823:Olfr1216 UTSW 2 89013378 missense probably benign 0.02
R1911:Olfr1216 UTSW 2 89013221 missense probably damaging 1.00
R2245:Olfr1216 UTSW 2 89013149 missense probably benign
R2331:Olfr1216 UTSW 2 89013921 missense probably benign
R3859:Olfr1216 UTSW 2 89014061 start codon destroyed probably null 1.00
R4579:Olfr1216 UTSW 2 89013144 missense probably benign
R5022:Olfr1216 UTSW 2 89014043 missense probably damaging 0.96
R5353:Olfr1216 UTSW 2 89013755 missense probably benign 0.00
R5894:Olfr1216 UTSW 2 89014055 missense probably damaging 1.00
R6240:Olfr1216 UTSW 2 89013626 missense probably benign 0.03
R7101:Olfr1216 UTSW 2 89013980 missense possibly damaging 0.90
R7652:Olfr1216 UTSW 2 89013549 missense probably benign 0.01
R8752:Olfr1216 UTSW 2 89013887 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGCTTCAGCAATGGAAAC -3'
(R):5'- ATCATCTACAGCCCTGCACTG -3'

Sequencing Primer
(F):5'- GCTTCAGCAATGGAAACAAGTC -3'
(R):5'- GCTGAGCTCCCCCATGTAC -3'
Posted On2020-07-13