Incidental Mutation 'R8243:Igfbp7'
ID637643
Institutional Source Beutler Lab
Gene Symbol Igfbp7
Ensembl Gene ENSMUSG00000036256
Gene Nameinsulin-like growth factor binding protein 7
SynonymsFstl2, mac25, AGM
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8243 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location77349240-77408041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 77401492 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 188 (E188V)
Ref Sequence ENSEMBL: ENSMUSP00000128318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046746] [ENSMUST00000163898]
Predicted Effect probably benign
Transcript: ENSMUST00000046746
SMART Domains Protein: ENSMUSP00000045057
Gene: ENSMUSG00000036256

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IB 30 113 9.23e-19 SMART
KAZAL 110 156 6.39e-12 SMART
IG 166 266 5.53e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163898
AA Change: E188V

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000128318
Gene: ENSMUSG00000036256
AA Change: E188V

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IB 30 113 9.23e-19 SMART
KAZAL 110 156 6.39e-12 SMART
IG 197 297 5.53e-6 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.7%
  • 20x: 96.0%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the insulin-like growth factor (IGF)-binding protein (IGFBP) family. IGFBPs bind IGFs with high affinity, and regulate IGF availability in body fluids and tissues and modulate IGF binding to its receptors. This protein binds IGF-I and IGF-II with relatively low affinity, and belongs to a subfamily of low-affinity IGFBPs. It also stimulates prostacyclin production and cell adhesion. Alternatively spliced transcript variants encoding different isoforms have been described for this gene, and one variant has been associated with retinal arterial macroaneurysm (PMID:21835307). [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit retarded mammary gland developmental in virgin and adult females, reduced mammary gland size and alveolar density during pregnancy, precocious involution in lactating mammary glands, and abnormal milk composition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T A 11: 46,125,082 H356Q probably damaging Het
BC030500 T C 8: 58,912,354 I13T unknown Het
Bcl6 C T 16: 23,968,133 C636Y probably damaging Het
Cabyr G T 18: 12,750,702 C82F probably benign Het
Clec4a1 T C 6: 122,924,819 V70A possibly damaging Het
Col11a1 C T 3: 114,061,492 P134S unknown Het
Col27a1 A G 4: 63,225,883 T603A probably damaging Het
Col6a6 T C 9: 105,699,269 D1964G probably damaging Het
Diexf T C 1: 193,114,629 D598G probably benign Het
Dnajc8 A G 4: 132,551,464 probably null Het
E330034G19Rik T C 14: 24,308,292 Y318H Het
Efemp1 T A 11: 28,921,690 S402T probably damaging Het
Emcn T C 3: 137,391,650 V110A possibly damaging Het
Fgd5 C T 6: 91,989,023 L746F possibly damaging Het
Gna13 A G 11: 109,396,413 N354S probably damaging Het
Helq G T 5: 100,770,482 S855R possibly damaging Het
Hps5 G T 7: 46,786,642 A160E probably damaging Het
Ivd A G 2: 118,871,537 Y150C probably damaging Het
Jade2 T C 11: 51,817,218 T723A probably benign Het
Kif1b T C 4: 149,204,267 N1239S probably benign Het
Klb A G 5: 65,378,995 N556S possibly damaging Het
Klhdc8a C T 1: 132,302,566 R140C possibly damaging Het
Klhl2 T A 8: 64,749,050 M531L probably benign Het
Mark3 T A 12: 111,647,522 S546R possibly damaging Het
Mfsd8 G A 3: 40,835,193 R140C probably damaging Het
Musk G A 4: 58,293,600 R63K probably benign Het
Nacad C T 11: 6,602,643 E183K probably damaging Het
Oasl1 T C 5: 114,928,161 Y113H probably benign Het
Olfr1216 T A 2: 89,013,707 Y119F probably benign Het
Olfr54 C T 11: 51,027,311 T103M probably benign Het
Olfr613 A T 7: 103,551,998 D71V probably damaging Het
Olfr923 A G 9: 38,828,507 E272G Het
Olfr980 A T 9: 40,006,188 C254S probably benign Het
P4hb T C 11: 120,563,380 D296G probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plekhh1 G A 12: 79,079,069 R1293H probably benign Het
Prss21 A G 17: 23,869,402 T114A probably damaging Het
Ptprn T C 1: 75,252,535 D776G probably damaging Het
Rffl A G 11: 82,812,795 C101R probably damaging Het
Rundc1 A G 11: 101,425,558 D152G probably benign Het
Sema6c A G 3: 95,172,605 T737A probably damaging Het
Sppl2c A G 11: 104,187,861 T496A probably damaging Het
Supt7l T C 5: 31,515,669 I412V probably benign Het
Trim38 T A 13: 23,791,395 I439N probably damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Usp18 G A 6: 121,269,144 R353H probably benign Het
Usp42 T C 5: 143,715,094 K1058R probably benign Het
Other mutations in Igfbp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Igfbp7 APN 5 77352037 splice site probably benign
IGL01528:Igfbp7 APN 5 77351332 missense probably damaging 1.00
IGL02964:Igfbp7 APN 5 77351341 missense possibly damaging 0.65
IGL03223:Igfbp7 APN 5 77349471 utr 3 prime probably benign
R0403:Igfbp7 UTSW 5 77355591 missense probably benign 0.36
R0639:Igfbp7 UTSW 5 77351980 missense probably damaging 1.00
R4647:Igfbp7 UTSW 5 77351296 missense possibly damaging 0.93
R4688:Igfbp7 UTSW 5 77407635 missense probably damaging 1.00
R4945:Igfbp7 UTSW 5 77351257 missense probably benign 0.44
R4970:Igfbp7 UTSW 5 77407761 missense possibly damaging 0.83
R7095:Igfbp7 UTSW 5 77401490 missense probably benign 0.28
R7332:Igfbp7 UTSW 5 77351956 missense probably damaging 1.00
R7751:Igfbp7 UTSW 5 77351287 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCTACAGTTTTCATGCCAC -3'
(R):5'- TGAGCTCCTGGAGTAGCTTTAG -3'

Sequencing Primer
(F):5'- TAACCTGAATGTGCCCGT -3'
(R):5'- CTCCTGGAGTAGCTTTAGAAAGG -3'
Posted On2020-07-13