Incidental Mutation 'R8243:Adam19'
ID 637660
Institutional Source Beutler Lab
Gene Symbol Adam19
Ensembl Gene ENSMUSG00000011256
Gene Name a disintegrin and metallopeptidase domain 19 (meltrin beta)
Synonyms Mltnb
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8243 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 46055992-46147343 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 46125082 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 356 (H356Q)
Ref Sequence ENSEMBL: ENSMUSP00000011400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011400]
AlphaFold O35674
Predicted Effect probably damaging
Transcript: ENSMUST00000011400
AA Change: H356Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000011400
Gene: ENSMUSG00000011256
AA Change: H356Q

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Pep_M12B_propep 32 163 9.4e-27 PFAM
Pfam:Reprolysin_5 209 388 1.9e-25 PFAM
Pfam:Reprolysin_4 209 399 1.5e-15 PFAM
Pfam:Reprolysin 211 409 1.3e-68 PFAM
Pfam:Reprolysin_2 231 399 6.1e-19 PFAM
Pfam:Reprolysin_3 235 357 1.2e-19 PFAM
DISIN 426 501 9.7e-41 SMART
ACR 502 650 7.46e-62 SMART
transmembrane domain 704 726 N/A INTRINSIC
low complexity region 788 797 N/A INTRINSIC
low complexity region 832 846 N/A INTRINSIC
low complexity region 886 905 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.7%
  • 20x: 96.0%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: This gene encodes a cell surface glycoprotein and member of the ADAM (a disintegrin and metalloproteinase) family of endopeptidases. The encoded protein may play a role in the ectodomain shedding of neuregulin proteins. Homozygous knockout mice for this gene exhibit heart development defects and perinatal lethality. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that undergoes proteolytic processing to generate a mature protein product. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice exhibit cardiac developmental defects and die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC030500 T C 8: 58,912,354 I13T unknown Het
Bcl6 C T 16: 23,968,133 C636Y probably damaging Het
Cabyr G T 18: 12,750,702 C82F probably benign Het
Clec4a1 T C 6: 122,924,819 V70A possibly damaging Het
Col11a1 C T 3: 114,061,492 P134S unknown Het
Col27a1 A G 4: 63,225,883 T603A probably damaging Het
Col6a6 T C 9: 105,699,269 D1964G probably damaging Het
Diexf T C 1: 193,114,629 D598G probably benign Het
Dnajc8 A G 4: 132,551,464 probably null Het
E330034G19Rik T C 14: 24,308,292 Y318H Het
Efemp1 T A 11: 28,921,690 S402T probably damaging Het
Emcn T C 3: 137,391,650 V110A possibly damaging Het
Fgd5 C T 6: 91,989,023 L746F possibly damaging Het
Gna13 A G 11: 109,396,413 N354S probably damaging Het
Helq G T 5: 100,770,482 S855R possibly damaging Het
Hps5 G T 7: 46,786,642 A160E probably damaging Het
Igfbp7 T A 5: 77,401,492 E188V probably benign Het
Ivd A G 2: 118,871,537 Y150C probably damaging Het
Jade2 T C 11: 51,817,218 T723A probably benign Het
Kif1b T C 4: 149,204,267 N1239S probably benign Het
Klb A G 5: 65,378,995 N556S possibly damaging Het
Klhdc8a C T 1: 132,302,566 R140C possibly damaging Het
Klhl2 T A 8: 64,749,050 M531L probably benign Het
Mark3 T A 12: 111,647,522 S546R possibly damaging Het
Mfsd8 G A 3: 40,835,193 R140C probably damaging Het
Musk G A 4: 58,293,600 R63K probably benign Het
Nacad C T 11: 6,602,643 E183K probably damaging Het
Oasl1 T C 5: 114,928,161 Y113H probably benign Het
Olfr1216 T A 2: 89,013,707 Y119F probably benign Het
Olfr54 C T 11: 51,027,311 T103M probably benign Het
Olfr613 A T 7: 103,551,998 D71V probably damaging Het
Olfr923 A G 9: 38,828,507 E272G Het
Olfr980 A T 9: 40,006,188 C254S probably benign Het
P4hb T C 11: 120,563,380 D296G probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plekhh1 G A 12: 79,079,069 R1293H probably benign Het
Prss21 A G 17: 23,869,402 T114A probably damaging Het
Ptprn T C 1: 75,252,535 D776G probably damaging Het
Rffl A G 11: 82,812,795 C101R probably damaging Het
Rundc1 A G 11: 101,425,558 D152G probably benign Het
Sema6c A G 3: 95,172,605 T737A probably damaging Het
Sppl2c A G 11: 104,187,861 T496A probably damaging Het
Supt7l T C 5: 31,515,669 I412V probably benign Het
Trim38 T A 13: 23,791,395 I439N probably damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Usp18 G A 6: 121,269,144 R353H probably benign Het
Usp42 T C 5: 143,715,094 K1058R probably benign Het
Other mutations in Adam19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Adam19 APN 11 46112783 missense probably damaging 1.00
IGL01727:Adam19 APN 11 46121553 missense probably benign
IGL01758:Adam19 APN 11 46112924 missense probably benign 0.01
IGL02160:Adam19 APN 11 46139695 missense probably damaging 0.99
IGL02421:Adam19 APN 11 46137553 missense probably damaging 0.96
IGL02572:Adam19 APN 11 46131721 nonsense probably null
IGL02995:Adam19 APN 11 46136349 missense probably benign 0.00
IGL03171:Adam19 APN 11 46138854 missense probably damaging 0.98
IGL03237:Adam19 APN 11 46137556 missense probably benign
R0003:Adam19 UTSW 11 46128789 missense probably damaging 1.00
R0026:Adam19 UTSW 11 46136259 missense probably damaging 1.00
R0158:Adam19 UTSW 11 46143034 missense probably damaging 1.00
R0304:Adam19 UTSW 11 46127392 missense possibly damaging 0.91
R0488:Adam19 UTSW 11 46138930 missense probably damaging 0.98
R0501:Adam19 UTSW 11 46123130 missense probably damaging 1.00
R0591:Adam19 UTSW 11 46121411 splice site probably benign
R0734:Adam19 UTSW 11 46127403 missense probably damaging 0.99
R0747:Adam19 UTSW 11 46118495 splice site probably null
R0771:Adam19 UTSW 11 46121453 missense possibly damaging 0.92
R1052:Adam19 UTSW 11 46127265 missense probably damaging 0.99
R1573:Adam19 UTSW 11 46113618 splice site probably benign
R1735:Adam19 UTSW 11 46138917 missense probably benign 0.26
R1830:Adam19 UTSW 11 46127278 missense probably damaging 0.98
R1911:Adam19 UTSW 11 46121454 missense probably damaging 1.00
R2092:Adam19 UTSW 11 46060904 splice site probably null
R3749:Adam19 UTSW 11 46137610 missense probably benign 0.00
R3893:Adam19 UTSW 11 46128838 missense probably damaging 1.00
R3916:Adam19 UTSW 11 46060935 missense probably benign 0.25
R3917:Adam19 UTSW 11 46060935 missense probably benign 0.25
R4506:Adam19 UTSW 11 46118444 missense possibly damaging 0.67
R4767:Adam19 UTSW 11 46138977 critical splice donor site probably null
R5055:Adam19 UTSW 11 46123169 missense probably damaging 1.00
R5313:Adam19 UTSW 11 46131776 missense probably damaging 1.00
R5329:Adam19 UTSW 11 46125026 missense probably damaging 0.99
R5567:Adam19 UTSW 11 46136250 missense probably damaging 1.00
R5602:Adam19 UTSW 11 46136315 missense probably benign
R6198:Adam19 UTSW 11 46121502 missense probably damaging 1.00
R6875:Adam19 UTSW 11 46112875 missense probably benign
R7011:Adam19 UTSW 11 46143018 missense probably benign 0.00
R7163:Adam19 UTSW 11 46131717 missense probably benign
R7213:Adam19 UTSW 11 46121471 missense probably benign 0.20
R7267:Adam19 UTSW 11 46121576 nonsense probably null
R7896:Adam19 UTSW 11 46137543 missense probably damaging 1.00
R8012:Adam19 UTSW 11 46065046 missense possibly damaging 0.74
R8059:Adam19 UTSW 11 46136466 splice site probably benign
R8357:Adam19 UTSW 11 46140112 missense probably damaging 0.96
R8419:Adam19 UTSW 11 46125023 missense possibly damaging 0.77
R8457:Adam19 UTSW 11 46140112 missense probably damaging 0.96
R9163:Adam19 UTSW 11 46127349 missense probably benign 0.02
R9349:Adam19 UTSW 11 46131743 nonsense probably null
R9489:Adam19 UTSW 11 46137622 missense probably benign 0.10
R9579:Adam19 UTSW 11 46118435 missense not run
X0067:Adam19 UTSW 11 46056115 start codon destroyed probably null 0.06
Predicted Primers PCR Primer
(F):5'- CGCTGTCAGGCTCAGATAAG -3'
(R):5'- TGCCTTCATCAACAGCTTGAAAG -3'

Sequencing Primer
(F):5'- TTTAATCCCAGCACTCAGGAGG -3'
(R):5'- CAACAGCTTGAAAGTTTCCCTGGG -3'
Posted On 2020-07-13