Incidental Mutation 'R8243:Jade2'
ID637662
Institutional Source Beutler Lab
Gene Symbol Jade2
Ensembl Gene ENSMUSG00000020387
Gene Namejade family PHD finger 2
SynonymsPhf15, 1200017K05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8243 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location51813455-51857653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51817218 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 723 (T723A)
Ref Sequence ENSEMBL: ENSMUSP00000020655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020655] [ENSMUST00000109090] [ENSMUST00000109091]
Predicted Effect probably benign
Transcript: ENSMUST00000020655
AA Change: T723A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020655
Gene: ENSMUSG00000020387
AA Change: T723A

DomainStartEndE-ValueType
Pfam:EPL1 39 177 3.4e-17 PFAM
PHD 201 247 1.35e-10 SMART
PHD 310 365 1.74e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109090
SMART Domains Protein: ENSMUSP00000104718
Gene: ENSMUSG00000020387

DomainStartEndE-ValueType
Pfam:EPL1 39 177 2e-17 PFAM
PHD 201 247 1.35e-10 SMART
PHD 310 365 1.74e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109091
AA Change: T723A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104719
Gene: ENSMUSG00000020387
AA Change: T723A

DomainStartEndE-ValueType
Pfam:EPL1 2 176 9.6e-9 PFAM
PHD 201 247 1.35e-10 SMART
PHD 310 365 1.74e-4 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.7%
  • 20x: 96.0%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T A 11: 46,125,082 H356Q probably damaging Het
BC030500 T C 8: 58,912,354 I13T unknown Het
Bcl6 C T 16: 23,968,133 C636Y probably damaging Het
Cabyr G T 18: 12,750,702 C82F probably benign Het
Clec4a1 T C 6: 122,924,819 V70A possibly damaging Het
Col11a1 C T 3: 114,061,492 P134S unknown Het
Col27a1 A G 4: 63,225,883 T603A probably damaging Het
Col6a6 T C 9: 105,699,269 D1964G probably damaging Het
Diexf T C 1: 193,114,629 D598G probably benign Het
Dnajc8 A G 4: 132,551,464 probably null Het
E330034G19Rik T C 14: 24,308,292 Y318H Het
Efemp1 T A 11: 28,921,690 S402T probably damaging Het
Emcn T C 3: 137,391,650 V110A possibly damaging Het
Fgd5 C T 6: 91,989,023 L746F possibly damaging Het
Gna13 A G 11: 109,396,413 N354S probably damaging Het
Helq G T 5: 100,770,482 S855R possibly damaging Het
Hps5 G T 7: 46,786,642 A160E probably damaging Het
Igfbp7 T A 5: 77,401,492 E188V probably benign Het
Ivd A G 2: 118,871,537 Y150C probably damaging Het
Kif1b T C 4: 149,204,267 N1239S probably benign Het
Klb A G 5: 65,378,995 N556S possibly damaging Het
Klhdc8a C T 1: 132,302,566 R140C possibly damaging Het
Klhl2 T A 8: 64,749,050 M531L probably benign Het
Mark3 T A 12: 111,647,522 S546R possibly damaging Het
Mfsd8 G A 3: 40,835,193 R140C probably damaging Het
Musk G A 4: 58,293,600 R63K probably benign Het
Nacad C T 11: 6,602,643 E183K probably damaging Het
Oasl1 T C 5: 114,928,161 Y113H probably benign Het
Olfr1216 T A 2: 89,013,707 Y119F probably benign Het
Olfr54 C T 11: 51,027,311 T103M probably benign Het
Olfr613 A T 7: 103,551,998 D71V probably damaging Het
Olfr923 A G 9: 38,828,507 E272G Het
Olfr980 A T 9: 40,006,188 C254S probably benign Het
P4hb T C 11: 120,563,380 D296G probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plekhh1 G A 12: 79,079,069 R1293H probably benign Het
Prss21 A G 17: 23,869,402 T114A probably damaging Het
Ptprn T C 1: 75,252,535 D776G probably damaging Het
Rffl A G 11: 82,812,795 C101R probably damaging Het
Rundc1 A G 11: 101,425,558 D152G probably benign Het
Sema6c A G 3: 95,172,605 T737A probably damaging Het
Sppl2c A G 11: 104,187,861 T496A probably damaging Het
Supt7l T C 5: 31,515,669 I412V probably benign Het
Trim38 T A 13: 23,791,395 I439N probably damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Usp18 G A 6: 121,269,144 R353H probably benign Het
Usp42 T C 5: 143,715,094 K1058R probably benign Het
Other mutations in Jade2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Jade2 APN 11 51825338 missense possibly damaging 0.95
IGL01935:Jade2 APN 11 51828384 missense possibly damaging 0.95
IGL02885:Jade2 APN 11 51831296 missense probably damaging 1.00
IGL02987:Jade2 APN 11 51830481 missense probably damaging 1.00
IGL02990:Jade2 APN 11 51831247 splice site probably benign
IGL03172:Jade2 APN 11 51825371 missense probably damaging 1.00
R0116:Jade2 UTSW 11 51831309 missense probably damaging 1.00
R1917:Jade2 UTSW 11 51818538 missense possibly damaging 0.95
R3410:Jade2 UTSW 11 51817223 missense probably benign
R3886:Jade2 UTSW 11 51830499 missense possibly damaging 0.79
R4846:Jade2 UTSW 11 51821148 missense probably benign
R4916:Jade2 UTSW 11 51817082 missense probably benign 0.01
R5420:Jade2 UTSW 11 51818607 missense probably benign 0.21
R5446:Jade2 UTSW 11 51816959 missense probably benign
R5657:Jade2 UTSW 11 51816987 missense probably damaging 1.00
R6031:Jade2 UTSW 11 51826586 nonsense probably null
R6031:Jade2 UTSW 11 51826586 nonsense probably null
R6116:Jade2 UTSW 11 51835633 missense probably damaging 0.99
R7039:Jade2 UTSW 11 51828359 missense probably damaging 0.97
R7270:Jade2 UTSW 11 51817184 missense possibly damaging 0.89
R7702:Jade2 UTSW 11 51816917 missense probably damaging 1.00
R7797:Jade2 UTSW 11 51817299 missense probably benign 0.00
R8054:Jade2 UTSW 11 51818614 missense probably benign 0.00
R8371:Jade2 UTSW 11 51825132 missense probably benign 0.04
Z1177:Jade2 UTSW 11 51816990 missense probably damaging 0.96
Z1177:Jade2 UTSW 11 51848994 missense probably null 0.20
Predicted Primers PCR Primer
(F):5'- GTGTCAAAATGCAGGCTGACC -3'
(R):5'- TGCTCAGCTTCATGAGGGAC -3'

Sequencing Primer
(F):5'- GGCTGACCTTTGGCCTC -3'
(R):5'- TGGTGACCCTGCCAGAAAG -3'
Posted On2020-07-13