Incidental Mutation 'R8004:Rbm44'
ID637682
Institutional Source Beutler Lab
Gene Symbol Rbm44
Ensembl Gene ENSMUSG00000070732
Gene NameRNA binding motif protein 44
SynonymsLOC329207
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R8004 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location91145089-91170795 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 91152158 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094698] [ENSMUST00000188818]
Predicted Effect probably benign
Transcript: ENSMUST00000094698
SMART Domains Protein: ENSMUSP00000092286
Gene: ENSMUSG00000070732

DomainStartEndE-ValueType
low complexity region 227 238 N/A INTRINSIC
low complexity region 444 460 N/A INTRINSIC
RRM 793 861 8.27e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188818
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (61/61)
MGI Phenotype PHENOTYPE: Male mice homozygous or heterozygous for a knock-out allele exhibit enhanced fertility with increased litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T A 1: 11,951,062 probably benign Het
Abcb11 T A 2: 69,257,210 K1070N possibly damaging Het
Ankrd24 T A 10: 81,638,357 N179K unknown Het
Atp6v0a4 A T 6: 38,050,549 F775L possibly damaging Het
Bbs2 A G 8: 94,082,490 V269A possibly damaging Het
Bpifc T G 10: 85,979,284 S273R probably benign Het
Cdan1 C T 2: 120,731,443 R20Q unknown Het
Chrm2 T A 6: 36,523,286 I26N probably damaging Het
Cngb3 A G 4: 19,505,273 K669E possibly damaging Het
Cnot1 T C 8: 95,752,752 I876V probably benign Het
Col12a1 T A 9: 79,684,401 T926S probably damaging Het
Cyp2b23 G T 7: 26,679,466 T191K probably benign Het
Dpp4 A G 2: 62,358,828 V453A probably benign Het
Eif2ak4 T C 2: 118,417,294 S271P possibly damaging Het
Fam69a T C 5: 107,909,666 D342G probably damaging Het
Fbxw20 G T 9: 109,221,381 P392H probably damaging Het
Fcho2 T A 13: 98,789,505 E118V possibly damaging Het
Gm2042 C G 12: 87,960,151 Q413E possibly damaging Het
Gm904 G A 13: 50,645,307 probably null Het
H2-D1 A G 17: 35,266,696 S352G probably benign Het
Igf2bp3 C A 6: 49,091,020 V451L probably benign Het
Igkv1-99 T C 6: 68,542,128 V23A Het
Igsf10 A G 3: 59,329,709 I1017T probably benign Het
Il18r1 G A 1: 40,474,757 C41Y probably damaging Het
Itgb4 A G 11: 115,982,705 D249G probably benign Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lrrn2 T A 1: 132,937,751 F185I probably damaging Het
Mllt6 G T 11: 97,676,140 E635D possibly damaging Het
Msh6 A G 17: 87,986,787 E990G probably damaging Het
Myo1h A T 5: 114,320,708 D184V Het
Nfatc2ip A G 7: 126,390,405 V269A possibly damaging Het
Nfkb1 C A 3: 135,591,551 probably benign Het
Nol12 A T 15: 78,940,517 K181N probably damaging Het
Npl T A 1: 153,503,540 T266S probably benign Het
Olfr195 T A 16: 59,148,988 V46E probably damaging Het
Olfr863-ps1 A T 9: 19,942,112 D109E possibly damaging Het
Oog2 A T 4: 144,194,251 I85L probably benign Het
Parm1 A C 5: 91,594,273 S167R probably benign Het
Pcsk4 T C 10: 80,322,840 D526G probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Psmd9 T C 5: 123,241,935 probably null Het
Ralgapa1 A G 12: 55,702,457 V1220A probably damaging Het
Rbm25 A T 12: 83,674,392 E577D possibly damaging Het
S100a6 T C 3: 90,613,812 F16L probably benign Het
Sar1a C A 10: 61,685,166 H53Q probably benign Het
Setd2 G A 9: 110,592,545 A282T Het
Slc35f5 A T 1: 125,589,887 H474L probably damaging Het
Slc4a3 T C 1: 75,549,067 probably null Het
Smc1b G A 15: 85,097,614 S735F probably damaging Het
Sp3 A T 2: 72,970,208 I531K possibly damaging Het
St6galnac5 A T 3: 152,840,165 M252K probably damaging Het
Tas2r120 T A 6: 132,657,427 H157Q possibly damaging Het
Tbc1d10b T A 7: 127,199,011 S653C probably damaging Het
Tex10 T C 4: 48,452,047 E693G possibly damaging Het
Thada A G 17: 84,192,205 S1855P probably benign Het
Tjp2 G A 19: 24,114,120 P559L probably damaging Het
Tmem184b A G 15: 79,362,766 S368P probably damaging Het
Tnc G A 4: 63,984,657 S1461L probably benign Het
Tnpo2 T C 8: 85,044,699 F177S probably benign Het
Vmn1r58 A T 7: 5,410,507 Y241* probably null Het
Wdr66 T C 5: 123,254,450 W216R unknown Het
Other mutations in Rbm44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Rbm44 APN 1 91157109 missense probably benign
IGL01089:Rbm44 APN 1 91168697 missense possibly damaging 0.61
IGL01339:Rbm44 APN 1 91168964 missense probably benign 0.45
IGL01410:Rbm44 APN 1 91168829 missense probably benign 0.01
IGL01624:Rbm44 APN 1 91156658 missense probably damaging 0.96
IGL01963:Rbm44 APN 1 91163108 missense probably benign 0.00
IGL02067:Rbm44 APN 1 91152845 missense probably damaging 0.98
IGL02513:Rbm44 APN 1 91155538 missense possibly damaging 0.63
IGL02804:Rbm44 APN 1 91150176 intron probably benign
IGL02806:Rbm44 APN 1 91153077 missense possibly damaging 0.79
IGL02887:Rbm44 APN 1 91153180 missense probably damaging 1.00
IGL03309:Rbm44 APN 1 91168840 critical splice donor site probably null
R0360:Rbm44 UTSW 1 91152347 missense probably benign 0.01
R0364:Rbm44 UTSW 1 91152347 missense probably benign 0.01
R0647:Rbm44 UTSW 1 91156928 missense probably benign 0.00
R1345:Rbm44 UTSW 1 91152759 missense probably damaging 0.99
R1352:Rbm44 UTSW 1 91153042 missense probably damaging 1.00
R1575:Rbm44 UTSW 1 91156843 splice site probably null
R1768:Rbm44 UTSW 1 91153957 splice site probably null
R4901:Rbm44 UTSW 1 91153328 missense probably benign 0.13
R4913:Rbm44 UTSW 1 91155494 missense probably damaging 1.00
R5023:Rbm44 UTSW 1 91169098 critical splice donor site probably null
R5569:Rbm44 UTSW 1 91168738 missense probably damaging 0.99
R5874:Rbm44 UTSW 1 91156840 critical splice donor site probably null
R5981:Rbm44 UTSW 1 91152689 missense possibly damaging 0.61
R6441:Rbm44 UTSW 1 91157077 missense probably damaging 0.98
R6515:Rbm44 UTSW 1 91165138 missense probably damaging 0.96
R7380:Rbm44 UTSW 1 91152216 missense possibly damaging 0.77
R7783:Rbm44 UTSW 1 91168829 missense probably benign 0.01
Z1176:Rbm44 UTSW 1 91153400 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAGTTCAGGGAGAAGCTTCC -3'
(R):5'- TCAAACTCACTTGACTGGGAG -3'

Sequencing Primer
(F):5'- GATTAATCCAATCCTGAGGGCCTG -3'
(R):5'- GACTGGGAGAAAATATTCCCTCTG -3'
Posted On2020-07-27