Incidental Mutation 'R8004:Nfkb1'
ID637683
Institutional Source Beutler Lab
Gene Symbol Nfkb1
Ensembl Gene ENSMUSG00000028163
Gene Namenuclear factor of kappa light polypeptide gene enhancer in B cells 1, p105
Synonymsp50 subunit of NF kappaB, nuclear factor kappaB p50, NF-kappaB, NF-kappaB p50, p50, p50/p105, NF kappaB1
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_008689.2; MGI: 97312

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8004 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location135584655-135691547 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 135591551 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029812] [ENSMUST00000164430] [ENSMUST00000196469]
Predicted Effect probably benign
Transcript: ENSMUST00000029812
SMART Domains Protein: ENSMUSP00000029812
Gene: ENSMUSG00000028163

DomainStartEndE-ValueType
Pfam:RHD 42 240 2.9e-75 PFAM
IPT 247 348 1.14e-22 SMART
low complexity region 368 414 N/A INTRINSIC
ANK 538 568 2.27e1 SMART
ANK 577 606 1.11e-2 SMART
ANK 610 640 2.47e0 SMART
ANK 646 675 5.53e-3 SMART
ANK 680 710 1.9e-1 SMART
ANK 714 743 2.18e-1 SMART
DEATH 801 888 1.9e-19 SMART
low complexity region 890 902 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132668
SMART Domains Protein: ENSMUSP00000114798
Gene: ENSMUSG00000028163

DomainStartEndE-ValueType
low complexity region 8 54 N/A INTRINSIC
Blast:IPT 55 156 4e-22 BLAST
ANK 178 208 2.27e1 SMART
ANK 217 246 1.11e-2 SMART
ANK 250 280 2.47e0 SMART
ANK 286 315 5.53e-3 SMART
ANK 320 350 1.9e-1 SMART
ANK 354 383 2.18e-1 SMART
Blast:DEATH 441 505 1e-34 BLAST
PDB:2DBF|A 442 505 5e-32 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000164430
SMART Domains Protein: ENSMUSP00000128345
Gene: ENSMUSG00000028163

DomainStartEndE-ValueType
Pfam:RHD_DNA_bind 42 240 2.9e-75 PFAM
IPT 247 348 1.14e-22 SMART
low complexity region 368 414 N/A INTRINSIC
ANK 538 568 2.27e1 SMART
ANK 577 606 1.11e-2 SMART
ANK 610 640 2.47e0 SMART
ANK 646 675 5.53e-3 SMART
ANK 680 710 1.9e-1 SMART
ANK 714 743 2.18e-1 SMART
DEATH 801 888 1.9e-19 SMART
low complexity region 890 902 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184550
Predicted Effect probably benign
Transcript: ENSMUST00000196469
SMART Domains Protein: ENSMUSP00000143601
Gene: ENSMUSG00000028163

DomainStartEndE-ValueType
Pfam:RHD_DNA_bind 42 90 2.5e-19 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (61/61)
MGI Phenotype Strain: 1857225
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 105 kD protein which can undergo cotranslational processing by the 26S proteasome to produce a 50 kD protein. The 105 kD protein is a Rel protein-specific transcription inhibitor and the 50 kD protein is a DNA binding subunit of the NF-kappa-B (NFKB) protein complex. NFKB is a transcription regulator that is activated by various intra- and extra-cellular stimuli such as cytokines, oxidant-free radicals, ultraviolet irradiation, and bacterial or viral products. Activated NFKB translocates into the nucleus and stimulates the expression of genes involved in a wide variety of biological functions. Inappropriate activation of NFKB has been associated with a number of inflammatory diseases while persistent inhibition of NFKB leads to inappropriate immune cell development or delayed cell growth. Alternative splicing results in multiple transcript variants encoding different isoforms, at least one of which is proteolytically processed. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous null mice have a decreased survivor rate, abnormal T cell development and decreased number of peripheral T cells, abnormal humoral responses with decreased immunoglobulin class switching, exhibit mild organ inflammation, and are susceptible toboth bacterial infections and hearing loss. [provided by MGI curators]
Allele List at MGI

All alleles(79) : Targeted(5) Gene trapped(74)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T A 1: 11,951,062 probably benign Het
Abcb11 T A 2: 69,257,210 K1070N possibly damaging Het
Ankrd24 T A 10: 81,638,357 N179K unknown Het
Atp6v0a4 A T 6: 38,050,549 F775L possibly damaging Het
Bbs2 A G 8: 94,082,490 V269A possibly damaging Het
Bpifc T G 10: 85,979,284 S273R probably benign Het
Cdan1 C T 2: 120,731,443 R20Q unknown Het
Chrm2 T A 6: 36,523,286 I26N probably damaging Het
Cngb3 A G 4: 19,505,273 K669E possibly damaging Het
Cnot1 T C 8: 95,752,752 I876V probably benign Het
Col12a1 T A 9: 79,684,401 T926S probably damaging Het
Cyp2b23 G T 7: 26,679,466 T191K probably benign Het
Dpp4 A G 2: 62,358,828 V453A probably benign Het
Eif2ak4 T C 2: 118,417,294 S271P possibly damaging Het
Fam69a T C 5: 107,909,666 D342G probably damaging Het
Fbxw20 G T 9: 109,221,381 P392H probably damaging Het
Fcho2 T A 13: 98,789,505 E118V possibly damaging Het
Gm2042 C G 12: 87,960,151 Q413E possibly damaging Het
Gm904 G A 13: 50,645,307 probably null Het
H2-D1 A G 17: 35,266,696 S352G probably benign Het
Igf2bp3 C A 6: 49,091,020 V451L probably benign Het
Igkv1-99 T C 6: 68,542,128 V23A Het
Igsf10 A G 3: 59,329,709 I1017T probably benign Het
Il18r1 G A 1: 40,474,757 C41Y probably damaging Het
Itgb4 A G 11: 115,982,705 D249G probably benign Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lrrn2 T A 1: 132,937,751 F185I probably damaging Het
Mllt6 G T 11: 97,676,140 E635D possibly damaging Het
Msh6 A G 17: 87,986,787 E990G probably damaging Het
Myo1h A T 5: 114,320,708 D184V Het
Nfatc2ip A G 7: 126,390,405 V269A possibly damaging Het
Nol12 A T 15: 78,940,517 K181N probably damaging Het
Npl T A 1: 153,503,540 T266S probably benign Het
Olfr195 T A 16: 59,148,988 V46E probably damaging Het
Olfr863-ps1 A T 9: 19,942,112 D109E possibly damaging Het
Oog2 A T 4: 144,194,251 I85L probably benign Het
Parm1 A C 5: 91,594,273 S167R probably benign Het
Pcsk4 T C 10: 80,322,840 D526G probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Psmd9 T C 5: 123,241,935 probably null Het
Ralgapa1 A G 12: 55,702,457 V1220A probably damaging Het
Rbm25 A T 12: 83,674,392 E577D possibly damaging Het
Rbm44 T A 1: 91,152,158 probably benign Het
S100a6 T C 3: 90,613,812 F16L probably benign Het
Sar1a C A 10: 61,685,166 H53Q probably benign Het
Setd2 G A 9: 110,592,545 A282T Het
Slc35f5 A T 1: 125,589,887 H474L probably damaging Het
Slc4a3 T C 1: 75,549,067 probably null Het
Smc1b G A 15: 85,097,614 S735F probably damaging Het
Sp3 A T 2: 72,970,208 I531K possibly damaging Het
St6galnac5 A T 3: 152,840,165 M252K probably damaging Het
Tas2r120 T A 6: 132,657,427 H157Q possibly damaging Het
Tbc1d10b T A 7: 127,199,011 S653C probably damaging Het
Tex10 T C 4: 48,452,047 E693G possibly damaging Het
Thada A G 17: 84,192,205 S1855P probably benign Het
Tjp2 G A 19: 24,114,120 P559L probably damaging Het
Tmem184b A G 15: 79,362,766 S368P probably damaging Het
Tnc G A 4: 63,984,657 S1461L probably benign Het
Tnpo2 T C 8: 85,044,699 F177S probably benign Het
Vmn1r58 A T 7: 5,410,507 Y241* probably null Het
Wdr66 T C 5: 123,254,450 W216R unknown Het
Other mutations in Nfkb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Nfkb1 APN 3 135590839 missense probably damaging 1.00
IGL01345:Nfkb1 APN 3 135594981 missense probably damaging 1.00
IGL01629:Nfkb1 APN 3 135601467 missense probably benign
IGL02216:Nfkb1 APN 3 135594963 missense probably damaging 0.98
IGL02273:Nfkb1 APN 3 135605207 missense probably benign 0.01
IGL02508:Nfkb1 APN 3 135590818 missense probably damaging 0.99
IGL03095:Nfkb1 APN 3 135618830 missense possibly damaging 0.48
Conversely UTSW 3 135626659 missense probably damaging 1.00
Finlay UTSW 3 135595053 nonsense probably null
Frisbee UTSW 3 135613943 missense possibly damaging 0.93
Honeyeater UTSW 3 135591551 splice site probably benign
kookaburra UTSW 3 135626611 nonsense probably null
Murgatroyd UTSW 3 135626710 missense possibly damaging 0.72
Poderoso UTSW 3 135613990 missense probably damaging 1.00
Puff UTSW 3 135595053 nonsense probably null
Roomba UTSW 3 135612412 critical splice donor site probably null
Wheelo UTSW 3 135615349 missense possibly damaging 0.81
R0026:Nfkb1 UTSW 3 135591573 missense probably damaging 1.00
R0047:Nfkb1 UTSW 3 135595053 nonsense probably null
R0989:Nfkb1 UTSW 3 135589396 missense probably benign 0.00
R1210:Nfkb1 UTSW 3 135594927 missense probably benign 0.03
R1661:Nfkb1 UTSW 3 135594957 missense probably damaging 1.00
R1665:Nfkb1 UTSW 3 135594957 missense probably damaging 1.00
R1725:Nfkb1 UTSW 3 135667758 missense probably damaging 1.00
R1984:Nfkb1 UTSW 3 135615349 missense possibly damaging 0.81
R1985:Nfkb1 UTSW 3 135615349 missense possibly damaging 0.81
R2154:Nfkb1 UTSW 3 135601479 missense probably benign 0.44
R2281:Nfkb1 UTSW 3 135601521 missense probably damaging 1.00
R2409:Nfkb1 UTSW 3 135613943 missense possibly damaging 0.93
R2504:Nfkb1 UTSW 3 135589329 missense possibly damaging 0.51
R4032:Nfkb1 UTSW 3 135594349 missense possibly damaging 0.63
R4232:Nfkb1 UTSW 3 135603770 missense probably damaging 1.00
R4936:Nfkb1 UTSW 3 135613982 missense probably damaging 0.97
R5085:Nfkb1 UTSW 3 135603807 missense probably benign 0.36
R5262:Nfkb1 UTSW 3 135612412 critical splice donor site probably null
R5384:Nfkb1 UTSW 3 135612542 missense possibly damaging 0.95
R5385:Nfkb1 UTSW 3 135612542 missense possibly damaging 0.95
R5434:Nfkb1 UTSW 3 135626611 nonsense probably null
R5663:Nfkb1 UTSW 3 135603851 missense possibly damaging 0.88
R5865:Nfkb1 UTSW 3 135603780 missense probably damaging 1.00
R6006:Nfkb1 UTSW 3 135603761 nonsense probably null
R6013:Nfkb1 UTSW 3 135626684 missense possibly damaging 0.86
R6234:Nfkb1 UTSW 3 135626710 missense possibly damaging 0.72
R6785:Nfkb1 UTSW 3 135615303 missense probably benign
R7175:Nfkb1 UTSW 3 135613990 missense probably damaging 1.00
R7227:Nfkb1 UTSW 3 135626659 missense probably damaging 1.00
R7394:Nfkb1 UTSW 3 135613697 missense possibly damaging 0.54
R7727:Nfkb1 UTSW 3 135585401 missense possibly damaging 0.48
R7815:Nfkb1 UTSW 3 135603791 missense probably damaging 1.00
R7849:Nfkb1 UTSW 3 135585412 missense
R8059:Nfkb1 UTSW 3 135593852 missense possibly damaging 0.54
X0050:Nfkb1 UTSW 3 135606623 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGACCTTCATCTTTCATGGATG -3'
(R):5'- TAGAGGTAACCTGTCCCTCG -3'

Sequencing Primer
(F):5'- CATCTTTCATGGATGAAGACCATC -3'
(R):5'- CTCGACATGGGAATCCTGTG -3'
Posted On2020-07-27