Incidental Mutation 'R8271:Mdh1b'
ID637689
Institutional Source Beutler Lab
Gene Symbol Mdh1b
Ensembl Gene ENSMUSG00000025963
Gene Namemalate dehydrogenase 1B, NAD (soluble)
Synonyms1700124B08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R8271 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location63698819-63730318 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 63720005 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 143 (V143M)
Ref Sequence ENSEMBL: ENSMUSP00000109728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114094]
Predicted Effect possibly damaging
Transcript: ENSMUST00000114094
AA Change: V143M

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109728
Gene: ENSMUSG00000025963
AA Change: V143M

DomainStartEndE-ValueType
low complexity region 69 81 N/A INTRINSIC
SCOP:d1b8pa1 131 282 1e-16 SMART
PDB:5MDH|B 131 457 3e-32 PDB
SCOP:d7mdha2 290 454 7e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A T 5: 8,686,212 I202L probably benign Het
Acadsb A T 7: 131,443,694 T452S unknown Het
Ago2 A T 15: 73,119,466 L541Q probably damaging Het
Ap2a2 A T 7: 141,620,899 E553V probably damaging Het
Astn2 T C 4: 65,992,426 K442E unknown Het
Bicd1 A G 6: 149,513,135 T449A probably benign Het
Btn1a1 T A 13: 23,461,749 Q150L probably benign Het
C1ra G A 6: 124,522,651 G599R probably damaging Het
Camta2 T A 11: 70,671,060 Q1076L probably benign Het
Capza2 T A 6: 17,657,215 C157S probably damaging Het
Ccnk A G 12: 108,195,855 probably benign Het
Chd3 T A 11: 69,360,657 D516V probably damaging Het
Cntnap5b A G 1: 100,072,107 T197A probably benign Het
Comp A G 8: 70,376,460 N260S probably damaging Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Ddx60 T A 8: 61,940,108 probably null Het
Defb22 C T 2: 152,485,792 V158I unknown Het
Diaph3 T C 14: 86,866,513 S812G probably damaging Het
Dohh G T 10: 81,386,010 Q79H probably benign Het
Dyrk1b T G 7: 28,182,655 V147G probably benign Het
Fastkd2 C T 1: 63,748,024 T539I probably benign Het
Gm7534 G T 4: 134,202,967 T9K unknown Het
Itpr3 G A 17: 27,087,648 D229N probably damaging Het
Kcnv1 A T 15: 45,109,358 D376E probably benign Het
Kif13a C A 13: 46,752,581 V1577F probably benign Het
L3mbtl4 G A 17: 68,486,943 R314H probably damaging Het
Mcoln2 A C 3: 146,192,424 N100T unknown Het
Mfsd4b4 G T 10: 39,892,105 Q377K probably benign Het
Mpv17l T C 16: 13,944,720 F122S probably damaging Het
Mylk T C 16: 34,922,579 S1154P probably damaging Het
Myo5b A G 18: 74,627,190 Y259C probably damaging Het
Nek1 G A 8: 61,105,612 V931M probably benign Het
Nkd2 C A 13: 73,821,318 G343V probably damaging Het
Obox8 T A 7: 14,332,003 T197S probably benign Het
Olfr1029 T C 2: 85,975,422 Y60H probably damaging Het
Olfr1029 T G 2: 85,975,741 M166R probably benign Het
Olfr1086 T A 2: 86,676,874 H153L probably benign Het
Olfr1272 A G 2: 90,282,272 F101S possibly damaging Het
Olfr16 T A 1: 172,957,177 C127* probably null Het
Olfr309 G A 7: 86,306,754 R120C probably benign Het
Olfr480 A G 7: 108,065,773 S342P probably damaging Het
Palb2 A T 7: 122,124,874 S551T probably damaging Het
Pcdha12 T A 18: 37,021,900 D557E probably damaging Het
Pcdhb21 T A 18: 37,515,868 D683E probably benign Het
Plekhb1 A G 7: 100,656,729 probably benign Het
Plekhg5 A G 4: 152,103,007 N90D probably damaging Het
Pnpla1 A G 17: 28,881,605 D482G probably benign Het
Rc3h1 A T 1: 160,940,759 probably benign Het
Rfpl4 C T 7: 5,110,540 R214H probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Setd5 T C 6: 113,115,070 I284T possibly damaging Het
Smurf1 C T 5: 144,894,087 E293K possibly damaging Het
Tas2r106 A T 6: 131,678,060 I276N probably damaging Het
Tbc1d2 C A 4: 46,649,791 A82S possibly damaging Het
Tex19.2 A G 11: 121,117,184 I146T possibly damaging Het
Tmem107 T G 11: 69,071,455 N79K probably damaging Het
Tpsab1 A T 17: 25,345,331 S50T probably benign Het
Ttn T A 2: 76,723,250 K31008* probably null Het
Ubox5 T C 2: 130,599,709 T353A probably benign Het
Usp24 T A 4: 106,428,514 H2445Q probably damaging Het
Uvrag T C 7: 98,888,491 D499G probably benign Het
Xndc1 A T 7: 102,079,136 N247I possibly damaging Het
Yipf2 A T 9: 21,589,995 W226R probably damaging Het
Zfp335 T A 2: 164,898,053 Q793L probably damaging Het
Zfp385c A G 11: 100,657,465 S54P probably damaging Het
Other mutations in Mdh1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01694:Mdh1b APN 1 63711106 splice site probably benign
IGL02314:Mdh1b APN 1 63711114 critical splice donor site probably null
IGL02390:Mdh1b APN 1 63721557 missense probably benign 0.27
IGL02582:Mdh1b APN 1 63719597 missense probably benign 0.08
IGL02864:Mdh1b APN 1 63721603 missense probably benign 0.00
IGL02887:Mdh1b APN 1 63715364 splice site probably benign
IGL03073:Mdh1b APN 1 63721487 critical splice donor site probably null
IGL03372:Mdh1b APN 1 63719995 missense possibly damaging 0.64
IGL02835:Mdh1b UTSW 1 63718657 missense probably damaging 1.00
R0015:Mdh1b UTSW 1 63721800 splice site probably benign
R0015:Mdh1b UTSW 1 63721800 splice site probably benign
R0255:Mdh1b UTSW 1 63719618 missense probably damaging 1.00
R1750:Mdh1b UTSW 1 63719522 missense probably benign
R2057:Mdh1b UTSW 1 63721582 missense probably benign 0.11
R3177:Mdh1b UTSW 1 63711531 missense possibly damaging 0.93
R3277:Mdh1b UTSW 1 63711531 missense possibly damaging 0.93
R3522:Mdh1b UTSW 1 63719768 missense probably damaging 0.97
R4938:Mdh1b UTSW 1 63711504 missense probably benign 0.00
R4967:Mdh1b UTSW 1 63719863 missense probably damaging 1.00
R5093:Mdh1b UTSW 1 63711461 missense probably benign 0.08
R5160:Mdh1b UTSW 1 63725645 missense probably null 0.01
R5311:Mdh1b UTSW 1 63720004 missense probably benign 0.00
R6345:Mdh1b UTSW 1 63715239 missense possibly damaging 0.52
R6974:Mdh1b UTSW 1 63721816 missense probably benign 0.00
R7073:Mdh1b UTSW 1 63721560 missense probably damaging 1.00
R7728:Mdh1b UTSW 1 63715270 missense probably benign 0.23
R7780:Mdh1b UTSW 1 63719974 missense possibly damaging 0.76
R8556:Mdh1b UTSW 1 63710982 splice site probably null
R8681:Mdh1b UTSW 1 63715201 missense probably benign
Z1176:Mdh1b UTSW 1 63711531 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTTACCGTGGTGCAGAAGGAC -3'
(R):5'- TGAATCATCTTTCAGAGCACATGC -3'

Sequencing Primer
(F):5'- TGCAGAAGGACACAGTGC -3'
(R):5'- AACTTTATATGCCCCGGTACAGG -3'
Posted On2020-07-28