Incidental Mutation 'R0726:Kif15'
ID63769
Institutional Source Beutler Lab
Gene Symbol Kif15
Ensembl Gene ENSMUSG00000036768
Gene Namekinesin family member 15
SynonymsHKLP2, Knsl7, N-10 kinesin
MMRRC Submission 038908-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0726 (G1)
Quality Score105
Status Validated
Chromosome9
Chromosomal Location122951046-123018733 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 122959928 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 62 (H62N)
Ref Sequence ENSEMBL: ENSMUSP00000149737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040717] [ENSMUST00000213745] [ENSMUST00000214652] [ENSMUST00000216388] [ENSMUST00000217401]
Predicted Effect probably benign
Transcript: ENSMUST00000040717
AA Change: H62N

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000035490
Gene: ENSMUSG00000036768
AA Change: H62N

DomainStartEndE-ValueType
KISc 24 371 2.86e-179 SMART
Pfam:Kinesin-relat_1 463 551 6.6e-26 PFAM
coiled coil region 579 643 N/A INTRINSIC
coiled coil region 706 1037 N/A INTRINSIC
coiled coil region 1065 1133 N/A INTRINSIC
Pfam:HMMR_C 1265 1387 3.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213745
AA Change: H62N

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000214652
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214921
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215176
Predicted Effect probably benign
Transcript: ENSMUST00000216388
Predicted Effect probably benign
Transcript: ENSMUST00000217401
AA Change: H62N

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
Meta Mutation Damage Score 0.0647 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.1%
  • 20x: 89.2%
Validation Efficiency 98% (90/92)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg12 T C 15: 88,806,647 Y256C probably damaging Het
Alox15 T A 11: 70,350,195 D160V probably damaging Het
Aox2 T C 1: 58,334,782 probably benign Het
Bbs9 G T 9: 22,793,823 A729S probably damaging Het
Bmp2k T A 5: 97,087,494 probably benign Het
Braf C T 6: 39,662,148 R223Q possibly damaging Het
Cd101 A T 3: 101,020,622 S48T possibly damaging Het
Cdh9 T G 15: 16,831,044 D322E probably benign Het
Col28a1 C T 6: 8,014,495 probably null Het
Cpxm1 G A 2: 130,390,939 R712W probably damaging Het
Csnk1g1 T C 9: 66,032,355 probably benign Het
Cyp2d37-ps A C 15: 82,690,449 noncoding transcript Het
Cyth3 T C 5: 143,692,642 V115A probably benign Het
Dnah9 C T 11: 65,965,681 V2885M probably damaging Het
Dock9 G T 14: 121,651,768 Y326* probably null Het
Espl1 T C 15: 102,322,598 I1844T probably benign Het
Fam105a A T 15: 27,656,947 I338N probably damaging Het
Fam20a T A 11: 109,677,194 N357Y probably damaging Het
Fancc C A 13: 63,323,411 R385L probably benign Het
Foxe3 A T 4: 114,925,250 L255H unknown Het
Frem2 T C 3: 53,519,626 D2967G possibly damaging Het
Gabra6 T G 11: 42,315,127 T301P probably damaging Het
Ganab T A 19: 8,911,113 Y511N probably damaging Het
Gm498 A G 7: 143,871,761 D49G probably damaging Het
Grm4 T A 17: 27,438,438 probably benign Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Kcnj9 G A 1: 172,325,921 S212F probably damaging Het
Kptn A G 7: 16,120,722 D106G probably damaging Het
Krtap13-1 T A 16: 88,729,304 S139T probably damaging Het
Lepr C A 4: 101,764,934 N354K probably benign Het
Lypd3 G T 7: 24,638,544 E112* probably null Het
Med13l A T 5: 118,748,684 N1550I probably damaging Het
Mettl2 C T 11: 105,126,844 P60L probably benign Het
Muc4 A G 16: 32,769,827 E850G probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Nek1 A G 8: 61,089,592 R739G probably damaging Het
Nipbl A T 15: 8,351,555 D584E probably benign Het
Nkain3 C T 4: 20,158,388 V162M possibly damaging Het
Nmrk1 T C 19: 18,641,480 probably benign Het
Nsd2 T C 5: 33,861,028 probably benign Het
Olfr1198 A T 2: 88,746,008 N293K probably benign Het
Olfr1270 T A 2: 90,149,283 H241L probably damaging Het
Olfr133 T C 17: 38,148,624 F12S probably damaging Het
Olfr1449 T A 19: 12,935,605 V289D probably damaging Het
Olfr907 T A 9: 38,499,122 M151K possibly damaging Het
Phex T A X: 157,372,561 probably benign Het
Pip5k1b G T 19: 24,378,892 D227E probably damaging Het
Prdm13 A G 4: 21,683,914 I119T unknown Het
Rab19 G T 6: 39,383,959 V14L probably benign Het
Rasa3 A G 8: 13,580,118 probably benign Het
Rgsl1 C T 1: 153,802,328 S118N probably damaging Het
Rif1 C T 2: 52,110,353 T1273M possibly damaging Het
Scn8a A G 15: 100,972,830 N254S probably damaging Het
Sema6a T C 18: 47,291,981 T188A probably damaging Het
Sh3pxd2a C T 19: 47,268,762 E506K probably damaging Het
Smarca2 A T 19: 26,698,403 K1014N probably damaging Het
Smarca4 T G 9: 21,700,139 probably null Het
Sntb1 T C 15: 55,676,356 R361G probably benign Het
Soga1 G T 2: 157,060,262 R278S probably damaging Het
Stx5a T A 19: 8,754,911 I208N probably damaging Het
Tas2r102 T A 6: 132,762,452 W108R probably damaging Het
Tcl1 A G 12: 105,218,670 Y94H probably damaging Het
Tenm3 T A 8: 48,236,594 Y1986F probably damaging Het
Tet2 G A 3: 133,468,184 P1439L probably benign Het
Tiam2 T C 17: 3,512,833 probably benign Het
Ubap2l G A 3: 90,021,246 T526M probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uhrf1bp1 T C 17: 27,885,489 V503A possibly damaging Het
Ushbp1 T A 8: 71,388,747 probably benign Het
Usp28 C T 9: 49,003,869 R115C probably damaging Het
Vldlr A T 19: 27,238,386 D261V probably damaging Het
Vmn2r5 C T 3: 64,503,765 D461N probably benign Het
Vmn2r86 A T 10: 130,446,396 F784I probably damaging Het
Zfp59 A T 7: 27,854,088 I322F probably damaging Het
Zfp607a A T 7: 27,879,149 H548L probably benign Het
Zfp626 G A 7: 27,818,623 C343Y probably damaging Het
Other mutations in Kif15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Kif15 APN 9 122975755 missense probably damaging 1.00
IGL01577:Kif15 APN 9 122996334 missense probably benign 0.06
IGL01647:Kif15 APN 9 122963471 intron probably benign
IGL01921:Kif15 APN 9 122979504 missense probably damaging 1.00
IGL02040:Kif15 APN 9 123017385 missense probably damaging 0.99
IGL02191:Kif15 APN 9 122975679 missense probably damaging 1.00
IGL02218:Kif15 APN 9 122995827 splice site probably benign
IGL02537:Kif15 APN 9 122993849 missense probably benign 0.08
IGL02814:Kif15 APN 9 123003640 missense possibly damaging 0.83
PIT4480001:Kif15 UTSW 9 123011543 missense probably benign
R0034:Kif15 UTSW 9 122999285 missense possibly damaging 0.47
R0458:Kif15 UTSW 9 123009359 missense probably benign
R0526:Kif15 UTSW 9 122997797 missense probably damaging 0.96
R0533:Kif15 UTSW 9 123009433 unclassified probably benign
R1580:Kif15 UTSW 9 122959956 missense probably benign 0.22
R1597:Kif15 UTSW 9 122994009 missense probably benign 0.22
R2096:Kif15 UTSW 9 122986187 missense probably damaging 1.00
R3125:Kif15 UTSW 9 122987961 missense probably damaging 0.99
R3176:Kif15 UTSW 9 122987840 splice site probably benign
R4088:Kif15 UTSW 9 122986189 missense probably benign 0.29
R4308:Kif15 UTSW 9 123013982 missense probably benign 0.00
R4597:Kif15 UTSW 9 122993849 missense probably benign 0.08
R4705:Kif15 UTSW 9 122959993 splice site probably null
R4832:Kif15 UTSW 9 123002126 splice site probably null
R5100:Kif15 UTSW 9 122991994 missense probably damaging 0.98
R5126:Kif15 UTSW 9 122975758 missense probably damaging 1.00
R5180:Kif15 UTSW 9 122999210 missense probably damaging 0.99
R5247:Kif15 UTSW 9 122986442 missense possibly damaging 0.65
R5376:Kif15 UTSW 9 122993971 missense probably benign 0.04
R5392:Kif15 UTSW 9 122996295 missense probably damaging 0.99
R5422:Kif15 UTSW 9 122984889 synonymous probably null
R5562:Kif15 UTSW 9 122978016 missense probably damaging 1.00
R5663:Kif15 UTSW 9 122991851 splice site probably null
R5767:Kif15 UTSW 9 123013974 missense possibly damaging 0.78
R5927:Kif15 UTSW 9 123017261 missense probably benign 0.00
R6049:Kif15 UTSW 9 123011622 missense probably damaging 0.98
R6435:Kif15 UTSW 9 122986491 missense probably damaging 1.00
R7040:Kif15 UTSW 9 123011614 missense possibly damaging 0.67
R7158:Kif15 UTSW 9 122999314 missense probably benign
R7163:Kif15 UTSW 9 123017657 missense probably damaging 1.00
R7197:Kif15 UTSW 9 123009926 critical splice donor site probably null
R7318:Kif15 UTSW 9 122987949 missense probably damaging 1.00
R7360:Kif15 UTSW 9 122991137 missense probably benign
R8039:Kif15 UTSW 9 123007425 missense possibly damaging 0.82
Z1177:Kif15 UTSW 9 122951051 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACAGGCAAGCTGAGATTCTGGTG -3'
(R):5'- ATTCACACAGTGGCAAGACTGAGG -3'

Sequencing Primer
(F):5'- CAAGCTGAGATTCTGGTGATTTTC -3'
(R):5'- AACCTGGAGACTTGCTCATGTC -3'
Posted On2013-07-30