Incidental Mutation 'R8271:Olfr1029'
ID637695
Institutional Source Beutler Lab
Gene Symbol Olfr1029
Ensembl Gene ENSMUSG00000059873
Gene Nameolfactory receptor 1029
SynonymsGA_x6K02T2Q125-47454152-47455126, MOR198-1P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R8271 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location85973895-85978913 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 85975741 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 166 (M166R)
Ref Sequence ENSEMBL: ENSMUSP00000080828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082191]
Predicted Effect probably benign
Transcript: ENSMUST00000082191
AA Change: M166R

PolyPhen 2 Score 0.395 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000080828
Gene: ENSMUSG00000059873
AA Change: M166R

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.2e-56 PFAM
Pfam:7tm_1 41 290 2.1e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A T 5: 8,686,212 I202L probably benign Het
Acadsb A T 7: 131,443,694 T452S unknown Het
Ago2 A T 15: 73,119,466 L541Q probably damaging Het
Ap2a2 A T 7: 141,620,899 E553V probably damaging Het
Astn2 T C 4: 65,992,426 K442E unknown Het
Bicd1 A G 6: 149,513,135 T449A probably benign Het
Btn1a1 T A 13: 23,461,749 Q150L probably benign Het
C1ra G A 6: 124,522,651 G599R probably damaging Het
Camta2 T A 11: 70,671,060 Q1076L probably benign Het
Capza2 T A 6: 17,657,215 C157S probably damaging Het
Ccnk A G 12: 108,195,855 probably benign Het
Chd3 T A 11: 69,360,657 D516V probably damaging Het
Cntnap5b A G 1: 100,072,107 T197A probably benign Het
Comp A G 8: 70,376,460 N260S probably damaging Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Ddx60 T A 8: 61,940,108 probably null Het
Defb22 C T 2: 152,485,792 V158I unknown Het
Diaph3 T C 14: 86,866,513 S812G probably damaging Het
Dohh G T 10: 81,386,010 Q79H probably benign Het
Dyrk1b T G 7: 28,182,655 V147G probably benign Het
Fastkd2 C T 1: 63,748,024 T539I probably benign Het
Gm7534 G T 4: 134,202,967 T9K unknown Het
Itpr3 G A 17: 27,087,648 D229N probably damaging Het
Kcnv1 A T 15: 45,109,358 D376E probably benign Het
Kif13a C A 13: 46,752,581 V1577F probably benign Het
L3mbtl4 G A 17: 68,486,943 R314H probably damaging Het
Mcoln2 A C 3: 146,192,424 N100T unknown Het
Mdh1b C T 1: 63,720,005 V143M possibly damaging Het
Mfsd4b4 G T 10: 39,892,105 Q377K probably benign Het
Mpv17l T C 16: 13,944,720 F122S probably damaging Het
Mylk T C 16: 34,922,579 S1154P probably damaging Het
Myo5b A G 18: 74,627,190 Y259C probably damaging Het
Nek1 G A 8: 61,105,612 V931M probably benign Het
Nkd2 C A 13: 73,821,318 G343V probably damaging Het
Obox8 T A 7: 14,332,003 T197S probably benign Het
Olfr1086 T A 2: 86,676,874 H153L probably benign Het
Olfr1272 A G 2: 90,282,272 F101S possibly damaging Het
Olfr16 T A 1: 172,957,177 C127* probably null Het
Olfr309 G A 7: 86,306,754 R120C probably benign Het
Olfr480 A G 7: 108,065,773 S342P probably damaging Het
Palb2 A T 7: 122,124,874 S551T probably damaging Het
Pcdha12 T A 18: 37,021,900 D557E probably damaging Het
Pcdhb21 T A 18: 37,515,868 D683E probably benign Het
Plekhb1 A G 7: 100,656,729 probably benign Het
Plekhg5 A G 4: 152,103,007 N90D probably damaging Het
Pnpla1 A G 17: 28,881,605 D482G probably benign Het
Rc3h1 A T 1: 160,940,759 probably benign Het
Rfpl4 C T 7: 5,110,540 R214H probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Setd5 T C 6: 113,115,070 I284T possibly damaging Het
Smurf1 C T 5: 144,894,087 E293K possibly damaging Het
Tas2r106 A T 6: 131,678,060 I276N probably damaging Het
Tbc1d2 C A 4: 46,649,791 A82S possibly damaging Het
Tex19.2 A G 11: 121,117,184 I146T possibly damaging Het
Tmem107 T G 11: 69,071,455 N79K probably damaging Het
Tpsab1 A T 17: 25,345,331 S50T probably benign Het
Ttn T A 2: 76,723,250 K31008* probably null Het
Ubox5 T C 2: 130,599,709 T353A probably benign Het
Usp24 T A 4: 106,428,514 H2445Q probably damaging Het
Uvrag T C 7: 98,888,491 D499G probably benign Het
Xndc1 A T 7: 102,079,136 N247I possibly damaging Het
Yipf2 A T 9: 21,589,995 W226R probably damaging Het
Zfp335 T A 2: 164,898,053 Q793L probably damaging Het
Zfp385c A G 11: 100,657,465 S54P probably damaging Het
Other mutations in Olfr1029
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02020:Olfr1029 APN 2 85975235 utr 5 prime probably benign
IGL02126:Olfr1029 APN 2 85976173 missense probably benign 0.00
IGL02584:Olfr1029 APN 2 85975875 missense probably damaging 0.96
IGL03410:Olfr1029 APN 2 85975420 missense probably damaging 0.99
R1466:Olfr1029 UTSW 2 85975995 missense probably damaging 1.00
R1466:Olfr1029 UTSW 2 85975995 missense probably damaging 1.00
R1499:Olfr1029 UTSW 2 85976028 missense possibly damaging 0.62
R1584:Olfr1029 UTSW 2 85975995 missense probably damaging 1.00
R2925:Olfr1029 UTSW 2 85975781 nonsense probably null
R2970:Olfr1029 UTSW 2 85976110 missense possibly damaging 0.75
R4571:Olfr1029 UTSW 2 85975831 missense probably damaging 0.97
R5533:Olfr1029 UTSW 2 85975453 missense possibly damaging 0.78
R5654:Olfr1029 UTSW 2 85976156 missense probably benign 0.00
R5827:Olfr1029 UTSW 2 85975306 missense probably benign 0.00
R5967:Olfr1029 UTSW 2 85976191 missense probably benign 0.01
R6291:Olfr1029 UTSW 2 85975582 missense probably damaging 1.00
R6735:Olfr1029 UTSW 2 85975434 missense possibly damaging 0.81
R6897:Olfr1029 UTSW 2 85975356 missense possibly damaging 0.45
R7053:Olfr1029 UTSW 2 85976014 missense possibly damaging 0.64
R7163:Olfr1029 UTSW 2 85975588 missense probably damaging 1.00
R7358:Olfr1029 UTSW 2 85975436 missense possibly damaging 0.81
R8047:Olfr1029 UTSW 2 85975927 missense possibly damaging 0.52
R8271:Olfr1029 UTSW 2 85975422 missense probably damaging 1.00
R8364:Olfr1029 UTSW 2 85976014 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TTGGCTGCTTTATCCAGTGC -3'
(R):5'- CAGCTGATTTGATCCTTAAGATGGC -3'

Sequencing Primer
(F):5'- TCATTGCACTTCTCCTTACAGAG -3'
(R):5'- GATCCTTAAGATGGCAGCAATAATG -3'
Posted On2020-07-28