Incidental Mutation 'R8271:Setd5'
ID637710
Institutional Source Beutler Lab
Gene Symbol Setd5
Ensembl Gene ENSMUSG00000034269
Gene NameSET domain containing 5
Synonyms2900045N06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8271 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location113077365-113153435 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113115070 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 284 (I284T)
Ref Sequence ENSEMBL: ENSMUSP00000108780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042889] [ENSMUST00000113155] [ENSMUST00000113157]
Predicted Effect probably benign
Transcript: ENSMUST00000042889
AA Change: I265T

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000047398
Gene: ENSMUSG00000034269
AA Change: I265T

DomainStartEndE-ValueType
low complexity region 165 180 N/A INTRINSIC
SET 272 396 1.09e-23 SMART
low complexity region 417 429 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 476 495 N/A INTRINSIC
low complexity region 539 552 N/A INTRINSIC
low complexity region 561 572 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 635 650 N/A INTRINSIC
low complexity region 850 866 N/A INTRINSIC
low complexity region 1082 1107 N/A INTRINSIC
low complexity region 1122 1138 N/A INTRINSIC
low complexity region 1250 1259 N/A INTRINSIC
low complexity region 1283 1301 N/A INTRINSIC
low complexity region 1335 1346 N/A INTRINSIC
low complexity region 1352 1372 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113155
AA Change: I284T

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108780
Gene: ENSMUSG00000034269
AA Change: I284T

DomainStartEndE-ValueType
low complexity region 65 76 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
SET 291 415 1.09e-23 SMART
low complexity region 436 448 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
low complexity region 558 571 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 619 640 N/A INTRINSIC
low complexity region 654 669 N/A INTRINSIC
low complexity region 869 885 N/A INTRINSIC
low complexity region 1101 1126 N/A INTRINSIC
low complexity region 1141 1157 N/A INTRINSIC
low complexity region 1269 1278 N/A INTRINSIC
low complexity region 1302 1320 N/A INTRINSIC
low complexity region 1354 1365 N/A INTRINSIC
low complexity region 1371 1391 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113157
AA Change: I284T

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108782
Gene: ENSMUSG00000034269
AA Change: I284T

DomainStartEndE-ValueType
low complexity region 65 76 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
SET 291 415 1.09e-23 SMART
low complexity region 436 448 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
low complexity region 558 571 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 619 640 N/A INTRINSIC
low complexity region 654 669 N/A INTRINSIC
low complexity region 869 885 N/A INTRINSIC
low complexity region 1101 1126 N/A INTRINSIC
low complexity region 1141 1157 N/A INTRINSIC
low complexity region 1269 1278 N/A INTRINSIC
low complexity region 1302 1320 N/A INTRINSIC
low complexity region 1354 1365 N/A INTRINSIC
low complexity region 1371 1391 N/A INTRINSIC
Meta Mutation Damage Score 0.1433 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This function of this gene has yet to be determined but mutations in this gene have been associated with autosomal dominant mental retardation-23. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A T 5: 8,686,212 I202L probably benign Het
Acadsb A T 7: 131,443,694 T452S unknown Het
Ago2 A T 15: 73,119,466 L541Q probably damaging Het
Ap2a2 A T 7: 141,620,899 E553V probably damaging Het
Astn2 T C 4: 65,992,426 K442E unknown Het
Bicd1 A G 6: 149,513,135 T449A probably benign Het
Btn1a1 T A 13: 23,461,749 Q150L probably benign Het
C1ra G A 6: 124,522,651 G599R probably damaging Het
Camta2 T A 11: 70,671,060 Q1076L probably benign Het
Capza2 T A 6: 17,657,215 C157S probably damaging Het
Ccnk A G 12: 108,195,855 probably benign Het
Chd3 T A 11: 69,360,657 D516V probably damaging Het
Cntnap5b A G 1: 100,072,107 T197A probably benign Het
Comp A G 8: 70,376,460 N260S probably damaging Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Ddx60 T A 8: 61,940,108 probably null Het
Defb22 C T 2: 152,485,792 V158I unknown Het
Diaph3 T C 14: 86,866,513 S812G probably damaging Het
Dohh G T 10: 81,386,010 Q79H probably benign Het
Dyrk1b T G 7: 28,182,655 V147G probably benign Het
Fastkd2 C T 1: 63,748,024 T539I probably benign Het
Gm7534 G T 4: 134,202,967 T9K unknown Het
Itpr3 G A 17: 27,087,648 D229N probably damaging Het
Kcnv1 A T 15: 45,109,358 D376E probably benign Het
Kif13a C A 13: 46,752,581 V1577F probably benign Het
L3mbtl4 G A 17: 68,486,943 R314H probably damaging Het
Mcoln2 A C 3: 146,192,424 N100T unknown Het
Mdh1b C T 1: 63,720,005 V143M possibly damaging Het
Mfsd4b4 G T 10: 39,892,105 Q377K probably benign Het
Mpv17l T C 16: 13,944,720 F122S probably damaging Het
Mylk T C 16: 34,922,579 S1154P probably damaging Het
Myo5b A G 18: 74,627,190 Y259C probably damaging Het
Nek1 G A 8: 61,105,612 V931M probably benign Het
Nkd2 C A 13: 73,821,318 G343V probably damaging Het
Obox8 T A 7: 14,332,003 T197S probably benign Het
Olfr1029 T C 2: 85,975,422 Y60H probably damaging Het
Olfr1029 T G 2: 85,975,741 M166R probably benign Het
Olfr1086 T A 2: 86,676,874 H153L probably benign Het
Olfr1272 A G 2: 90,282,272 F101S possibly damaging Het
Olfr16 T A 1: 172,957,177 C127* probably null Het
Olfr309 G A 7: 86,306,754 R120C probably benign Het
Olfr480 A G 7: 108,065,773 S342P probably damaging Het
Palb2 A T 7: 122,124,874 S551T probably damaging Het
Pcdha12 T A 18: 37,021,900 D557E probably damaging Het
Pcdhb21 T A 18: 37,515,868 D683E probably benign Het
Plekhb1 A G 7: 100,656,729 probably benign Het
Plekhg5 A G 4: 152,103,007 N90D probably damaging Het
Pnpla1 A G 17: 28,881,605 D482G probably benign Het
Rc3h1 A T 1: 160,940,759 probably benign Het
Rfpl4 C T 7: 5,110,540 R214H probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Smurf1 C T 5: 144,894,087 E293K possibly damaging Het
Tas2r106 A T 6: 131,678,060 I276N probably damaging Het
Tbc1d2 C A 4: 46,649,791 A82S possibly damaging Het
Tex19.2 A G 11: 121,117,184 I146T possibly damaging Het
Tmem107 T G 11: 69,071,455 N79K probably damaging Het
Tpsab1 A T 17: 25,345,331 S50T probably benign Het
Ttn T A 2: 76,723,250 K31008* probably null Het
Ubox5 T C 2: 130,599,709 T353A probably benign Het
Usp24 T A 4: 106,428,514 H2445Q probably damaging Het
Uvrag T C 7: 98,888,491 D499G probably benign Het
Xndc1 A T 7: 102,079,136 N247I possibly damaging Het
Yipf2 A T 9: 21,589,995 W226R probably damaging Het
Zfp335 T A 2: 164,898,053 Q793L probably damaging Het
Zfp385c A G 11: 100,657,465 S54P probably damaging Het
Other mutations in Setd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Setd5 APN 6 113111414 missense probably damaging 1.00
IGL02102:Setd5 APN 6 113150985 nonsense probably null
IGL02105:Setd5 APN 6 113117580 missense probably damaging 1.00
IGL02202:Setd5 APN 6 113151015 missense probably benign 0.01
IGL02221:Setd5 APN 6 113121170 splice site probably benign
IGL02382:Setd5 APN 6 113143640 missense probably benign
IGL02394:Setd5 APN 6 113110898 missense probably benign 0.00
IGL02442:Setd5 APN 6 113110380 missense possibly damaging 0.93
IGL02480:Setd5 APN 6 113143809 missense probably damaging 1.00
IGL02940:Setd5 APN 6 113114938 missense possibly damaging 0.92
R0320:Setd5 UTSW 6 113111481 missense probably damaging 1.00
R0479:Setd5 UTSW 6 113115033 missense probably damaging 1.00
R0514:Setd5 UTSW 6 113119437 nonsense probably null
R1528:Setd5 UTSW 6 113121738 missense probably damaging 0.99
R1530:Setd5 UTSW 6 113109913 missense probably damaging 1.00
R2176:Setd5 UTSW 6 113151153 missense probably benign 0.23
R2191:Setd5 UTSW 6 113111429 nonsense probably null
R2286:Setd5 UTSW 6 113119610 missense possibly damaging 0.69
R4163:Setd5 UTSW 6 113119584 missense probably benign
R4294:Setd5 UTSW 6 113111320 intron probably benign
R4300:Setd5 UTSW 6 113150162 missense probably damaging 1.00
R4342:Setd5 UTSW 6 113111320 intron probably benign
R4370:Setd5 UTSW 6 113121805 missense probably damaging 1.00
R4854:Setd5 UTSW 6 113151399 missense probably damaging 1.00
R4858:Setd5 UTSW 6 113149566 missense probably damaging 1.00
R5057:Setd5 UTSW 6 113137961 missense probably damaging 0.96
R5345:Setd5 UTSW 6 113116007 missense probably damaging 1.00
R5529:Setd5 UTSW 6 113121568 missense probably damaging 1.00
R5556:Setd5 UTSW 6 113147502 missense probably benign 0.00
R5582:Setd5 UTSW 6 113114925 missense probably damaging 1.00
R5838:Setd5 UTSW 6 113119435 missense probably benign 0.40
R5941:Setd5 UTSW 6 113128490 missense probably damaging 1.00
R6009:Setd5 UTSW 6 113110519 missense probably damaging 0.99
R6146:Setd5 UTSW 6 113121812 critical splice donor site probably null
R6394:Setd5 UTSW 6 113115544 missense probably damaging 1.00
R6694:Setd5 UTSW 6 113143708 missense probably benign
R7058:Setd5 UTSW 6 113115571 missense probably benign 0.16
R7060:Setd5 UTSW 6 113117382 missense probably damaging 1.00
R7199:Setd5 UTSW 6 113121138 missense probably benign 0.03
R7238:Setd5 UTSW 6 113121130 missense probably damaging 1.00
R7296:Setd5 UTSW 6 113147557 missense probably benign 0.21
R7438:Setd5 UTSW 6 113115082 missense possibly damaging 0.74
R7515:Setd5 UTSW 6 113110889 missense probably damaging 1.00
R7621:Setd5 UTSW 6 113144049 missense possibly damaging 0.85
R7652:Setd5 UTSW 6 113121764 missense probably damaging 1.00
R7986:Setd5 UTSW 6 113128457 missense probably benign 0.00
R8083:Setd5 UTSW 6 113115010 missense probably damaging 1.00
R8175:Setd5 UTSW 6 113114913 missense probably damaging 1.00
R8252:Setd5 UTSW 6 113150955 missense probably benign 0.01
R8268:Setd5 UTSW 6 113149690 critical splice donor site probably null
R8424:Setd5 UTSW 6 113149683 missense probably benign 0.12
R8508:Setd5 UTSW 6 113121087 missense probably damaging 1.00
R8801:Setd5 UTSW 6 113150892 missense possibly damaging 0.95
X0017:Setd5 UTSW 6 113150168 missense probably null 1.00
Z1176:Setd5 UTSW 6 113138096 missense probably benign
Z1191:Setd5 UTSW 6 113114996 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ATTCTCCCTCGGAAGCACAG -3'
(R):5'- CATGTGCCTAGACAGTTTAGTTAC -3'

Sequencing Primer
(F):5'- TTCTCCCTCGGAAGCACAGAATTTAG -3'
(R):5'- TCAGCAGGAAGGTAGTTC -3'
Posted On2020-07-28