Incidental Mutation 'R8271:Dyrk1b'
ID637716
Institutional Source Beutler Lab
Gene Symbol Dyrk1b
Ensembl Gene ENSMUSG00000002409
Gene Namedual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1b
SynonymsMirk
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8271 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location28179469-28187294 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 28182655 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 147 (V147G)
Ref Sequence ENSEMBL: ENSMUSP00000133431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042405] [ENSMUST00000085901] [ENSMUST00000172467] [ENSMUST00000172761]
Predicted Effect probably benign
Transcript: ENSMUST00000042405
SMART Domains Protein: ENSMUSP00000037613
Gene: ENSMUSG00000046865

DomainStartEndE-ValueType
low complexity region 8 85 N/A INTRINSIC
Fibrillarin 94 321 9.92e-176 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085901
AA Change: V87G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000083064
Gene: ENSMUSG00000002409
AA Change: V87G

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 22 41 N/A INTRINSIC
S_TKc 111 431 3.75e-78 SMART
low complexity region 438 454 N/A INTRINSIC
low complexity region 460 477 N/A INTRINSIC
low complexity region 542 561 N/A INTRINSIC
low complexity region 571 591 N/A INTRINSIC
low complexity region 597 615 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172467
AA Change: V147G

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000133431
Gene: ENSMUSG00000002409
AA Change: V147G

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 22 41 N/A INTRINSIC
S_TKc 111 431 3.75e-78 SMART
low complexity region 438 454 N/A INTRINSIC
low complexity region 460 477 N/A INTRINSIC
low complexity region 542 561 N/A INTRINSIC
low complexity region 571 591 N/A INTRINSIC
low complexity region 597 615 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172761
AA Change: V87G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000133719
Gene: ENSMUSG00000002409
AA Change: V87G

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 22 41 N/A INTRINSIC
S_TKc 111 391 1.52e-78 SMART
low complexity region 398 414 N/A INTRINSIC
low complexity region 420 437 N/A INTRINSIC
low complexity region 502 521 N/A INTRINSIC
low complexity region 531 551 N/A INTRINSIC
low complexity region 557 575 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of nuclear-localized protein kinases. The encoded protein participates in the regulation of the cell cycle. Expression of this gene may be altered in tumor cells, and mutations in this gene were found to cause abdominal obesity-metabolic syndrome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A T 5: 8,686,212 I202L probably benign Het
Acadsb A T 7: 131,443,694 T452S unknown Het
Ago2 A T 15: 73,119,466 L541Q probably damaging Het
Ap2a2 A T 7: 141,620,899 E553V probably damaging Het
Astn2 T C 4: 65,992,426 K442E unknown Het
Bicd1 A G 6: 149,513,135 T449A probably benign Het
Btn1a1 T A 13: 23,461,749 Q150L probably benign Het
C1ra G A 6: 124,522,651 G599R probably damaging Het
Camta2 T A 11: 70,671,060 Q1076L probably benign Het
Capza2 T A 6: 17,657,215 C157S probably damaging Het
Ccnk A G 12: 108,195,855 probably benign Het
Chd3 T A 11: 69,360,657 D516V probably damaging Het
Cntnap5b A G 1: 100,072,107 T197A probably benign Het
Comp A G 8: 70,376,460 N260S probably damaging Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Ddx60 T A 8: 61,940,108 probably null Het
Defb22 C T 2: 152,485,792 V158I unknown Het
Diaph3 T C 14: 86,866,513 S812G probably damaging Het
Dohh G T 10: 81,386,010 Q79H probably benign Het
Fastkd2 C T 1: 63,748,024 T539I probably benign Het
Gm7534 G T 4: 134,202,967 T9K unknown Het
Itpr3 G A 17: 27,087,648 D229N probably damaging Het
Kcnv1 A T 15: 45,109,358 D376E probably benign Het
Kif13a C A 13: 46,752,581 V1577F probably benign Het
L3mbtl4 G A 17: 68,486,943 R314H probably damaging Het
Mcoln2 A C 3: 146,192,424 N100T unknown Het
Mdh1b C T 1: 63,720,005 V143M possibly damaging Het
Mfsd4b4 G T 10: 39,892,105 Q377K probably benign Het
Mpv17l T C 16: 13,944,720 F122S probably damaging Het
Mylk T C 16: 34,922,579 S1154P probably damaging Het
Myo5b A G 18: 74,627,190 Y259C probably damaging Het
Nek1 G A 8: 61,105,612 V931M probably benign Het
Nkd2 C A 13: 73,821,318 G343V probably damaging Het
Obox8 T A 7: 14,332,003 T197S probably benign Het
Olfr1029 T C 2: 85,975,422 Y60H probably damaging Het
Olfr1029 T G 2: 85,975,741 M166R probably benign Het
Olfr1086 T A 2: 86,676,874 H153L probably benign Het
Olfr1272 A G 2: 90,282,272 F101S possibly damaging Het
Olfr16 T A 1: 172,957,177 C127* probably null Het
Olfr309 G A 7: 86,306,754 R120C probably benign Het
Olfr480 A G 7: 108,065,773 S342P probably damaging Het
Palb2 A T 7: 122,124,874 S551T probably damaging Het
Pcdha12 T A 18: 37,021,900 D557E probably damaging Het
Pcdhb21 T A 18: 37,515,868 D683E probably benign Het
Plekhb1 A G 7: 100,656,729 probably benign Het
Plekhg5 A G 4: 152,103,007 N90D probably damaging Het
Pnpla1 A G 17: 28,881,605 D482G probably benign Het
Rc3h1 A T 1: 160,940,759 probably benign Het
Rfpl4 C T 7: 5,110,540 R214H probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Setd5 T C 6: 113,115,070 I284T possibly damaging Het
Smurf1 C T 5: 144,894,087 E293K possibly damaging Het
Tas2r106 A T 6: 131,678,060 I276N probably damaging Het
Tbc1d2 C A 4: 46,649,791 A82S possibly damaging Het
Tex19.2 A G 11: 121,117,184 I146T possibly damaging Het
Tmem107 T G 11: 69,071,455 N79K probably damaging Het
Tpsab1 A T 17: 25,345,331 S50T probably benign Het
Ttn T A 2: 76,723,250 K31008* probably null Het
Ubox5 T C 2: 130,599,709 T353A probably benign Het
Usp24 T A 4: 106,428,514 H2445Q probably damaging Het
Uvrag T C 7: 98,888,491 D499G probably benign Het
Xndc1 A T 7: 102,079,136 N247I possibly damaging Het
Yipf2 A T 9: 21,589,995 W226R probably damaging Het
Zfp335 T A 2: 164,898,053 Q793L probably damaging Het
Zfp385c A G 11: 100,657,465 S54P probably damaging Het
Other mutations in Dyrk1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01483:Dyrk1b APN 7 28182676 missense probably damaging 0.96
IGL01820:Dyrk1b APN 7 28181600 utr 5 prime probably benign
IGL03155:Dyrk1b APN 7 28182687 missense probably benign 0.25
R0280:Dyrk1b UTSW 7 28184312 missense probably damaging 1.00
R0323:Dyrk1b UTSW 7 28185356 missense probably benign 0.00
R0610:Dyrk1b UTSW 7 28186634 missense probably damaging 0.99
R0765:Dyrk1b UTSW 7 28185711 intron probably benign
R1858:Dyrk1b UTSW 7 28182646 splice site probably null
R2354:Dyrk1b UTSW 7 28185372 missense possibly damaging 0.79
R4599:Dyrk1b UTSW 7 28182431 missense probably damaging 1.00
R4655:Dyrk1b UTSW 7 28185751 missense probably damaging 0.97
R5201:Dyrk1b UTSW 7 28185096 missense probably damaging 1.00
R5357:Dyrk1b UTSW 7 28185318 missense possibly damaging 0.79
R5560:Dyrk1b UTSW 7 28184253 missense possibly damaging 0.53
R6171:Dyrk1b UTSW 7 28186550 critical splice acceptor site probably null
R6751:Dyrk1b UTSW 7 28186709 missense probably damaging 1.00
R6901:Dyrk1b UTSW 7 28185117 missense probably damaging 1.00
R6918:Dyrk1b UTSW 7 28185925 missense probably damaging 0.99
R7699:Dyrk1b UTSW 7 28184312 missense probably damaging 1.00
R7700:Dyrk1b UTSW 7 28184312 missense probably damaging 1.00
R8177:Dyrk1b UTSW 7 28183176 missense possibly damaging 0.86
X0060:Dyrk1b UTSW 7 28183150 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTGGACCTCATCAAGACCTACAAG -3'
(R):5'- TGAACCAGTGAACCACTCGG -3'

Sequencing Primer
(F):5'- TACAAGCACATCAATGAGGTAAAGC -3'
(R):5'- TGAACCACTCGGGGAGG -3'
Posted On2020-07-28