Incidental Mutation 'R8271:Acadsb'
ID637722
Institutional Source Beutler Lab
Gene Symbol Acadsb
Ensembl Gene ENSMUSG00000030861
Gene Nameacyl-Coenzyme A dehydrogenase, short/branched chain
Synonyms1300003O09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8271 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location131410601-131448944 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 131443694 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 452 (T452S)
Ref Sequence ENSEMBL: ENSMUSP00000113948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015829] [ENSMUST00000117518] [ENSMUST00000124096]
Predicted Effect probably benign
Transcript: ENSMUST00000015829
SMART Domains Protein: ENSMUSP00000015829
Gene: ENSMUSG00000030861

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 58 170 9.9e-30 PFAM
Pfam:Acyl-CoA_dh_M 173 268 6.9e-29 PFAM
Pfam:Acyl-CoA_dh_1 280 428 6.5e-51 PFAM
Pfam:Acyl-CoA_dh_2 295 418 4.4e-26 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000117518
AA Change: T452S
SMART Domains Protein: ENSMUSP00000113948
Gene: ENSMUSG00000030861
AA Change: T452S

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 58 170 2.9e-29 PFAM
Pfam:Acyl-CoA_dh_M 173 268 1.2e-28 PFAM
Pfam:Acyl-CoA_dh_1 280 414 1.4e-41 PFAM
Pfam:Acyl-CoA_dh_2 295 415 2.6e-24 PFAM
transmembrane domain 417 439 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Short/branched chain acyl-CoA dehydrogenase(ACADSB) is a member of the acyl-CoA dehydrogenase family of enzymes that catalyze the dehydrogenation of acyl-CoA derivatives in the metabolism of fatty acids or branch chained amino acids. Substrate specificity is the primary characteristic used to define members of this gene family. The ACADSB gene product has the greatest activity towards the short branched chain acyl-CoA derivative, (S)-2-methylbutyryl-CoA, but also reacts significantly with other 2-methyl branched chain substrates and with short straight chain acyl-CoAs. The cDNA encodes for a mitochondrial precursor protein which is cleaved upon mitochondrial import and predicted to yield a mature peptide of approximately 43.7-KDa. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A T 5: 8,686,212 I202L probably benign Het
Ago2 A T 15: 73,119,466 L541Q probably damaging Het
Ap2a2 A T 7: 141,620,899 E553V probably damaging Het
Astn2 T C 4: 65,992,426 K442E unknown Het
Bicd1 A G 6: 149,513,135 T449A probably benign Het
Btn1a1 T A 13: 23,461,749 Q150L probably benign Het
C1ra G A 6: 124,522,651 G599R probably damaging Het
Camta2 T A 11: 70,671,060 Q1076L probably benign Het
Capza2 T A 6: 17,657,215 C157S probably damaging Het
Ccnk A G 12: 108,195,855 probably benign Het
Chd3 T A 11: 69,360,657 D516V probably damaging Het
Cntnap5b A G 1: 100,072,107 T197A probably benign Het
Comp A G 8: 70,376,460 N260S probably damaging Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Ddx60 T A 8: 61,940,108 probably null Het
Defb22 C T 2: 152,485,792 V158I unknown Het
Diaph3 T C 14: 86,866,513 S812G probably damaging Het
Dohh G T 10: 81,386,010 Q79H probably benign Het
Dyrk1b T G 7: 28,182,655 V147G probably benign Het
Fastkd2 C T 1: 63,748,024 T539I probably benign Het
Gm7534 G T 4: 134,202,967 T9K unknown Het
Itpr3 G A 17: 27,087,648 D229N probably damaging Het
Kcnv1 A T 15: 45,109,358 D376E probably benign Het
Kif13a C A 13: 46,752,581 V1577F probably benign Het
L3mbtl4 G A 17: 68,486,943 R314H probably damaging Het
Mcoln2 A C 3: 146,192,424 N100T unknown Het
Mdh1b C T 1: 63,720,005 V143M possibly damaging Het
Mfsd4b4 G T 10: 39,892,105 Q377K probably benign Het
Mpv17l T C 16: 13,944,720 F122S probably damaging Het
Mylk T C 16: 34,922,579 S1154P probably damaging Het
Myo5b A G 18: 74,627,190 Y259C probably damaging Het
Nek1 G A 8: 61,105,612 V931M probably benign Het
Nkd2 C A 13: 73,821,318 G343V probably damaging Het
Obox8 T A 7: 14,332,003 T197S probably benign Het
Olfr1029 T C 2: 85,975,422 Y60H probably damaging Het
Olfr1029 T G 2: 85,975,741 M166R probably benign Het
Olfr1086 T A 2: 86,676,874 H153L probably benign Het
Olfr1272 A G 2: 90,282,272 F101S possibly damaging Het
Olfr16 T A 1: 172,957,177 C127* probably null Het
Olfr309 G A 7: 86,306,754 R120C probably benign Het
Olfr480 A G 7: 108,065,773 S342P probably damaging Het
Palb2 A T 7: 122,124,874 S551T probably damaging Het
Pcdha12 T A 18: 37,021,900 D557E probably damaging Het
Pcdhb21 T A 18: 37,515,868 D683E probably benign Het
Plekhb1 A G 7: 100,656,729 probably benign Het
Plekhg5 A G 4: 152,103,007 N90D probably damaging Het
Pnpla1 A G 17: 28,881,605 D482G probably benign Het
Rc3h1 A T 1: 160,940,759 probably benign Het
Rfpl4 C T 7: 5,110,540 R214H probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Setd5 T C 6: 113,115,070 I284T possibly damaging Het
Smurf1 C T 5: 144,894,087 E293K possibly damaging Het
Tas2r106 A T 6: 131,678,060 I276N probably damaging Het
Tbc1d2 C A 4: 46,649,791 A82S possibly damaging Het
Tex19.2 A G 11: 121,117,184 I146T possibly damaging Het
Tmem107 T G 11: 69,071,455 N79K probably damaging Het
Tpsab1 A T 17: 25,345,331 S50T probably benign Het
Ttn T A 2: 76,723,250 K31008* probably null Het
Ubox5 T C 2: 130,599,709 T353A probably benign Het
Usp24 T A 4: 106,428,514 H2445Q probably damaging Het
Uvrag T C 7: 98,888,491 D499G probably benign Het
Xndc1 A T 7: 102,079,136 N247I possibly damaging Het
Yipf2 A T 9: 21,589,995 W226R probably damaging Het
Zfp335 T A 2: 164,898,053 Q793L probably damaging Het
Zfp385c A G 11: 100,657,465 S54P probably damaging Het
Other mutations in Acadsb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00581:Acadsb APN 7 131437496 intron probably benign
IGL02002:Acadsb APN 7 131428529 missense probably damaging 1.00
IGL02147:Acadsb APN 7 131425881 splice site probably benign
IGL02614:Acadsb APN 7 131424628 missense probably benign 0.00
IGL03038:Acadsb APN 7 131428456 missense probably damaging 1.00
IGL03083:Acadsb APN 7 131441193 intron probably benign
R0491:Acadsb UTSW 7 131430107 missense probably benign 0.41
R0562:Acadsb UTSW 7 131425789 nonsense probably null
R0989:Acadsb UTSW 7 131428544 missense probably damaging 0.99
R1701:Acadsb UTSW 7 131424484 missense probably benign 0.00
R1827:Acadsb UTSW 7 131441275 missense probably damaging 1.00
R1860:Acadsb UTSW 7 131444229 splice site probably null
R2256:Acadsb UTSW 7 131443653 missense probably benign 0.23
R3798:Acadsb UTSW 7 131431965 missense probably damaging 1.00
R4519:Acadsb UTSW 7 131430004 missense probably damaging 0.99
R5020:Acadsb UTSW 7 131441200 critical splice acceptor site probably null
R5048:Acadsb UTSW 7 131437469 missense probably damaging 1.00
R5243:Acadsb UTSW 7 131444243 missense probably damaging 1.00
R5519:Acadsb UTSW 7 131429965 missense probably damaging 1.00
R5788:Acadsb UTSW 7 131443599 missense probably benign 0.23
R5855:Acadsb UTSW 7 131424599 missense probably damaging 1.00
R6399:Acadsb UTSW 7 131430055 missense probably damaging 1.00
R6896:Acadsb UTSW 7 131443646 missense probably benign 0.23
R6970:Acadsb UTSW 7 131434315 missense possibly damaging 0.85
R7031:Acadsb UTSW 7 131443637 missense probably benign 0.23
R7126:Acadsb UTSW 7 131437448 missense probably benign 0.01
R7138:Acadsb UTSW 7 131441239 missense probably damaging 1.00
R7571:Acadsb UTSW 7 131443554 missense probably damaging 1.00
R7697:Acadsb UTSW 7 131429969 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTACACCAAAGATTACCCTGTG -3'
(R):5'- TGATGAGGAAGCTGCCTTCTG -3'

Sequencing Primer
(F):5'- ACCCTGTGGAGAAATTCTTCCGAG -3'
(R):5'- GGAAGCTGCCTTCTGAAATTAGAACC -3'
Posted On2020-07-28