Incidental Mutation 'R8271:Comp'
ID637726
Institutional Source Beutler Lab
Gene Symbol Comp
Ensembl Gene ENSMUSG00000031849
Gene Namecartilage oligomeric matrix protein
Synonymsthrombospondin-5, TSP5
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.348) question?
Stock #R8271 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location70373558-70382066 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70376460 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 260 (N260S)
Ref Sequence ENSEMBL: ENSMUSP00000003659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003659]
PDB Structure Storage function of COMP:the crystal structure of the coiled-coil domain in complex with vitamin D3 [X-RAY DIFFRACTION]
COMPcc in complex with fatty acids [X-RAY DIFFRACTION]
COMPcc in complex with fatty acids [X-RAY DIFFRACTION]
COMPcc in complex with fatty acids [X-RAY DIFFRACTION]
COMPcc in complex with fatty acids [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000003659
AA Change: N260S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000003659
Gene: ENSMUSG00000031849
AA Change: N260S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:COMP 28 72 6.2e-22 PFAM
EGF 88 124 8.19e-2 SMART
EGF_CA 125 177 5.08e-7 SMART
EGF_CA 178 220 1.73e-9 SMART
EGF 226 265 7.53e-1 SMART
Pfam:TSP_3 299 334 6.1e-16 PFAM
Pfam:TSP_3 358 393 1.2e-15 PFAM
Pfam:TSP_3 393 416 2.7e-6 PFAM
Pfam:TSP_3 417 454 1.6e-14 PFAM
Pfam:TSP_3 455 490 3.7e-14 PFAM
Pfam:TSP_3 491 526 6.1e-15 PFAM
Pfam:TSP_C 544 741 2.6e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212488
Predicted Effect probably benign
Transcript: ENSMUST00000213072
Meta Mutation Damage Score 0.1960 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a noncollagenous extracellular matrix (ECM) protein. It consists of five identical glycoprotein subunits, each with EGF-like and calcium-binding (thrombospondin-like) domains. Oligomerization results from formation of a five-stranded coiled coil and disulfides. Binding to other ECM proteins such as collagen appears to depend on divalent cations. Contraction or expansion of a 5 aa aspartate repeat and other mutations can cause pseudochondroplasia (PSACH) and multiple epiphyseal dysplasia (MED). [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation are indistinguishable from controls. Mice homozygous for a knockin allele with two point mutations exhibit short limb dwarfism, osteoarthritis, abnormal chondrocytes, mild myopathy, and abnormal tendon morphology and stiffness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A T 5: 8,686,212 I202L probably benign Het
Acadsb A T 7: 131,443,694 T452S unknown Het
Ago2 A T 15: 73,119,466 L541Q probably damaging Het
Ap2a2 A T 7: 141,620,899 E553V probably damaging Het
Astn2 T C 4: 65,992,426 K442E unknown Het
Bicd1 A G 6: 149,513,135 T449A probably benign Het
Btn1a1 T A 13: 23,461,749 Q150L probably benign Het
C1ra G A 6: 124,522,651 G599R probably damaging Het
Camta2 T A 11: 70,671,060 Q1076L probably benign Het
Capza2 T A 6: 17,657,215 C157S probably damaging Het
Ccnk A G 12: 108,195,855 probably benign Het
Chd3 T A 11: 69,360,657 D516V probably damaging Het
Cntnap5b A G 1: 100,072,107 T197A probably benign Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Ddx60 T A 8: 61,940,108 probably null Het
Defb22 C T 2: 152,485,792 V158I unknown Het
Diaph3 T C 14: 86,866,513 S812G probably damaging Het
Dohh G T 10: 81,386,010 Q79H probably benign Het
Dyrk1b T G 7: 28,182,655 V147G probably benign Het
Fastkd2 C T 1: 63,748,024 T539I probably benign Het
Gm7534 G T 4: 134,202,967 T9K unknown Het
Itpr3 G A 17: 27,087,648 D229N probably damaging Het
Kcnv1 A T 15: 45,109,358 D376E probably benign Het
Kif13a C A 13: 46,752,581 V1577F probably benign Het
L3mbtl4 G A 17: 68,486,943 R314H probably damaging Het
Mcoln2 A C 3: 146,192,424 N100T unknown Het
Mdh1b C T 1: 63,720,005 V143M possibly damaging Het
Mfsd4b4 G T 10: 39,892,105 Q377K probably benign Het
Mpv17l T C 16: 13,944,720 F122S probably damaging Het
Mylk T C 16: 34,922,579 S1154P probably damaging Het
Myo5b A G 18: 74,627,190 Y259C probably damaging Het
Nek1 G A 8: 61,105,612 V931M probably benign Het
Nkd2 C A 13: 73,821,318 G343V probably damaging Het
Obox8 T A 7: 14,332,003 T197S probably benign Het
Olfr1029 T C 2: 85,975,422 Y60H probably damaging Het
Olfr1029 T G 2: 85,975,741 M166R probably benign Het
Olfr1086 T A 2: 86,676,874 H153L probably benign Het
Olfr1272 A G 2: 90,282,272 F101S possibly damaging Het
Olfr16 T A 1: 172,957,177 C127* probably null Het
Olfr309 G A 7: 86,306,754 R120C probably benign Het
Olfr480 A G 7: 108,065,773 S342P probably damaging Het
Palb2 A T 7: 122,124,874 S551T probably damaging Het
Pcdha12 T A 18: 37,021,900 D557E probably damaging Het
Pcdhb21 T A 18: 37,515,868 D683E probably benign Het
Plekhb1 A G 7: 100,656,729 probably benign Het
Plekhg5 A G 4: 152,103,007 N90D probably damaging Het
Pnpla1 A G 17: 28,881,605 D482G probably benign Het
Rc3h1 A T 1: 160,940,759 probably benign Het
Rfpl4 C T 7: 5,110,540 R214H probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Setd5 T C 6: 113,115,070 I284T possibly damaging Het
Smurf1 C T 5: 144,894,087 E293K possibly damaging Het
Tas2r106 A T 6: 131,678,060 I276N probably damaging Het
Tbc1d2 C A 4: 46,649,791 A82S possibly damaging Het
Tex19.2 A G 11: 121,117,184 I146T possibly damaging Het
Tmem107 T G 11: 69,071,455 N79K probably damaging Het
Tpsab1 A T 17: 25,345,331 S50T probably benign Het
Ttn T A 2: 76,723,250 K31008* probably null Het
Ubox5 T C 2: 130,599,709 T353A probably benign Het
Usp24 T A 4: 106,428,514 H2445Q probably damaging Het
Uvrag T C 7: 98,888,491 D499G probably benign Het
Xndc1 A T 7: 102,079,136 N247I possibly damaging Het
Yipf2 A T 9: 21,589,995 W226R probably damaging Het
Zfp335 T A 2: 164,898,053 Q793L probably damaging Het
Zfp385c A G 11: 100,657,465 S54P probably damaging Het
Other mutations in Comp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01596:Comp APN 8 70378635 missense probably damaging 1.00
IGL02110:Comp APN 8 70373639 missense probably benign 0.08
IGL02721:Comp APN 8 70376081 missense probably damaging 1.00
IGL02812:Comp APN 8 70376687 missense possibly damaging 0.75
IGL03023:Comp APN 8 70378610 unclassified probably benign
BB007:Comp UTSW 8 70373853 missense probably damaging 1.00
BB017:Comp UTSW 8 70373853 missense probably damaging 1.00
IGL03047:Comp UTSW 8 70374909 missense possibly damaging 0.65
R0217:Comp UTSW 8 70378908 missense probably damaging 1.00
R0503:Comp UTSW 8 70375734 missense possibly damaging 0.58
R0659:Comp UTSW 8 70379101 missense possibly damaging 0.84
R1490:Comp UTSW 8 70373913 missense possibly damaging 0.63
R1663:Comp UTSW 8 70373600 missense possibly damaging 0.93
R1666:Comp UTSW 8 70378957 splice site probably null
R1668:Comp UTSW 8 70378957 splice site probably null
R1789:Comp UTSW 8 70377146 missense probably benign 0.01
R2096:Comp UTSW 8 70376063 missense probably damaging 1.00
R2157:Comp UTSW 8 70379570 nonsense probably null
R3836:Comp UTSW 8 70373859 missense probably benign 0.26
R4630:Comp UTSW 8 70374382 missense possibly damaging 0.94
R4743:Comp UTSW 8 70376061 missense probably damaging 1.00
R4747:Comp UTSW 8 70376702 missense probably damaging 1.00
R5028:Comp UTSW 8 70376640 missense probably damaging 0.99
R5070:Comp UTSW 8 70376495 missense probably benign 0.25
R5083:Comp UTSW 8 70381300 missense probably damaging 1.00
R5917:Comp UTSW 8 70376361 splice site probably null
R6705:Comp UTSW 8 70376737 missense probably damaging 0.98
R6965:Comp UTSW 8 70376514 missense probably damaging 1.00
R7309:Comp UTSW 8 70373678 splice site probably null
R7402:Comp UTSW 8 70377204 missense probably benign 0.01
R7501:Comp UTSW 8 70379409 missense possibly damaging 0.82
R7541:Comp UTSW 8 70381350 missense probably damaging 1.00
R7568:Comp UTSW 8 70373859 missense probably benign 0.26
R7930:Comp UTSW 8 70373853 missense probably damaging 1.00
R8103:Comp UTSW 8 70381286 missense probably damaging 1.00
R8259:Comp UTSW 8 70379054 missense probably damaging 1.00
R8677:Comp UTSW 8 70380260 missense probably damaging 1.00
Z1177:Comp UTSW 8 70377221 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TTGACTCCATCAAGGCCCAAATG -3'
(R):5'- GGTCACAAGCATCTCCGATG -3'

Sequencing Primer
(F):5'- ACCTAGGGCTCCTTCCAGTG -3'
(R):5'- CAGTTGTCCTGGGAAGCAG -3'
Posted On2020-07-28