Incidental Mutation 'R8271:Dcp1a'
ID637738
Institutional Source Beutler Lab
Gene Symbol Dcp1a
Ensembl Gene ENSMUSG00000021962
Gene Namedecapping mRNA 1A
Synonyms1110066A22Rik, Mitc1, 4930568L04Rik, SMIF, D14Ertd817e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.240) question?
Stock #R8271 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location30479535-30527063 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30522926 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 570 (T570A)
Ref Sequence ENSEMBL: ENSMUSP00000022535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022535] [ENSMUST00000225196] [ENSMUST00000225286]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022535
AA Change: T570A

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022535
Gene: ENSMUSG00000021962
AA Change: T570A

DomainStartEndE-ValueType
Pfam:DCP1 28 144 1.8e-44 PFAM
low complexity region 327 343 N/A INTRINSIC
low complexity region 457 472 N/A INTRINSIC
Pfam:mRNA_decap_C 559 601 6.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223658
Predicted Effect possibly damaging
Transcript: ENSMUST00000225196
AA Change: T570A

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000225286
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Decapping is a key step in general and regulated mRNA decay. The protein encoded by this gene is a decapping enzyme. This protein and another decapping enzyme form a decapping complex, which interacts with the nonsense-mediated decay factor hUpf1 and may be recruited to mRNAs containing premature termination codons. This protein also participates in the TGF-beta signaling pathway. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A T 5: 8,686,212 I202L probably benign Het
Acadsb A T 7: 131,443,694 T452S unknown Het
Ago2 A T 15: 73,119,466 L541Q probably damaging Het
Ap2a2 A T 7: 141,620,899 E553V probably damaging Het
Astn2 T C 4: 65,992,426 K442E unknown Het
Bicd1 A G 6: 149,513,135 T449A probably benign Het
Btn1a1 T A 13: 23,461,749 Q150L probably benign Het
C1ra G A 6: 124,522,651 G599R probably damaging Het
Camta2 T A 11: 70,671,060 Q1076L probably benign Het
Capza2 T A 6: 17,657,215 C157S probably damaging Het
Ccnk A G 12: 108,195,855 probably benign Het
Chd3 T A 11: 69,360,657 D516V probably damaging Het
Cntnap5b A G 1: 100,072,107 T197A probably benign Het
Comp A G 8: 70,376,460 N260S probably damaging Het
Ddx60 T A 8: 61,940,108 probably null Het
Defb22 C T 2: 152,485,792 V158I unknown Het
Diaph3 T C 14: 86,866,513 S812G probably damaging Het
Dohh G T 10: 81,386,010 Q79H probably benign Het
Dyrk1b T G 7: 28,182,655 V147G probably benign Het
Fastkd2 C T 1: 63,748,024 T539I probably benign Het
Gm7534 G T 4: 134,202,967 T9K unknown Het
Itpr3 G A 17: 27,087,648 D229N probably damaging Het
Kcnv1 A T 15: 45,109,358 D376E probably benign Het
Kif13a C A 13: 46,752,581 V1577F probably benign Het
L3mbtl4 G A 17: 68,486,943 R314H probably damaging Het
Mcoln2 A C 3: 146,192,424 N100T unknown Het
Mdh1b C T 1: 63,720,005 V143M possibly damaging Het
Mfsd4b4 G T 10: 39,892,105 Q377K probably benign Het
Mpv17l T C 16: 13,944,720 F122S probably damaging Het
Mylk T C 16: 34,922,579 S1154P probably damaging Het
Myo5b A G 18: 74,627,190 Y259C probably damaging Het
Nek1 G A 8: 61,105,612 V931M probably benign Het
Nkd2 C A 13: 73,821,318 G343V probably damaging Het
Obox8 T A 7: 14,332,003 T197S probably benign Het
Olfr1029 T C 2: 85,975,422 Y60H probably damaging Het
Olfr1029 T G 2: 85,975,741 M166R probably benign Het
Olfr1086 T A 2: 86,676,874 H153L probably benign Het
Olfr1272 A G 2: 90,282,272 F101S possibly damaging Het
Olfr16 T A 1: 172,957,177 C127* probably null Het
Olfr309 G A 7: 86,306,754 R120C probably benign Het
Olfr480 A G 7: 108,065,773 S342P probably damaging Het
Palb2 A T 7: 122,124,874 S551T probably damaging Het
Pcdha12 T A 18: 37,021,900 D557E probably damaging Het
Pcdhb21 T A 18: 37,515,868 D683E probably benign Het
Plekhb1 A G 7: 100,656,729 probably benign Het
Plekhg5 A G 4: 152,103,007 N90D probably damaging Het
Pnpla1 A G 17: 28,881,605 D482G probably benign Het
Rc3h1 A T 1: 160,940,759 probably benign Het
Rfpl4 C T 7: 5,110,540 R214H probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Setd5 T C 6: 113,115,070 I284T possibly damaging Het
Smurf1 C T 5: 144,894,087 E293K possibly damaging Het
Tas2r106 A T 6: 131,678,060 I276N probably damaging Het
Tbc1d2 C A 4: 46,649,791 A82S possibly damaging Het
Tex19.2 A G 11: 121,117,184 I146T possibly damaging Het
Tmem107 T G 11: 69,071,455 N79K probably damaging Het
Tpsab1 A T 17: 25,345,331 S50T probably benign Het
Ttn T A 2: 76,723,250 K31008* probably null Het
Ubox5 T C 2: 130,599,709 T353A probably benign Het
Usp24 T A 4: 106,428,514 H2445Q probably damaging Het
Uvrag T C 7: 98,888,491 D499G probably benign Het
Xndc1 A T 7: 102,079,136 N247I possibly damaging Het
Yipf2 A T 9: 21,589,995 W226R probably damaging Het
Zfp335 T A 2: 164,898,053 Q793L probably damaging Het
Zfp385c A G 11: 100,657,465 S54P probably damaging Het
Other mutations in Dcp1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01653:Dcp1a APN 14 30505571 missense possibly damaging 0.52
IGL02698:Dcp1a APN 14 30505542 splice site probably benign
IGL02799:Dcp1a UTSW 14 30519679 critical splice donor site probably null
R0240:Dcp1a UTSW 14 30484594 splice site probably benign
R0387:Dcp1a UTSW 14 30519679 critical splice donor site probably null
R0646:Dcp1a UTSW 14 30502885 missense probably damaging 1.00
R1781:Dcp1a UTSW 14 30513075 missense probably benign 0.37
R1843:Dcp1a UTSW 14 30518983 missense probably damaging 0.99
R2111:Dcp1a UTSW 14 30519370 missense probably benign 0.00
R3176:Dcp1a UTSW 14 30505542 splice site probably benign
R4948:Dcp1a UTSW 14 30479767 missense probably damaging 1.00
R5541:Dcp1a UTSW 14 30502839 missense probably damaging 1.00
R6178:Dcp1a UTSW 14 30523304 makesense probably null
R7767:Dcp1a UTSW 14 30479818 critical splice donor site probably null
R7818:Dcp1a UTSW 14 30479721 missense probably damaging 0.99
R8248:Dcp1a UTSW 14 30479598 intron probably benign
R8248:Dcp1a UTSW 14 30522926 missense possibly damaging 0.87
R8250:Dcp1a UTSW 14 30522926 missense possibly damaging 0.87
R8297:Dcp1a UTSW 14 30522926 missense possibly damaging 0.87
R8302:Dcp1a UTSW 14 30522926 missense possibly damaging 0.87
R8326:Dcp1a UTSW 14 30519570 nonsense probably null
R8333:Dcp1a UTSW 14 30522926 missense possibly damaging 0.87
R8818:Dcp1a UTSW 14 30518942 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- ATTCTGTGTCCCGGCAGATTG -3'
(R):5'- CCAGAGGCAGTTACAATGACAG -3'

Sequencing Primer
(F):5'- CAGATTGCAGGCTCTCCATTGG -3'
(R):5'- TGACAGTCCAGGTTTACAGC -3'
Posted On2020-07-28