Incidental Mutation 'R8271:Kcnv1'
ID637740
Institutional Source Beutler Lab
Gene Symbol Kcnv1
Ensembl Gene ENSMUSG00000022342
Gene Namepotassium channel, subfamily V, member 1
Synonyms2700023A03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8271 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location45106284-45114920 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45109358 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 376 (D376E)
Ref Sequence ENSEMBL: ENSMUSP00000022967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022967]
Predicted Effect probably benign
Transcript: ENSMUST00000022967
AA Change: D376E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000022967
Gene: ENSMUSG00000022342
AA Change: D376E

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
BTB 42 160 1.17e-12 SMART
Pfam:Ion_trans 212 440 8.9e-45 PFAM
Pfam:Ion_trans_2 350 436 3.9e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium voltage-gated channel subfamily V. This protein is essentially present in the brain, and its role might be to inhibit the function of a particular class of outward rectifier potassium channel types. [provided by RefSeq, Jul 2008]
PHENOTYPE: At weaning, homozygous mutant mice exhibit tetany, tremors and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A T 5: 8,686,212 I202L probably benign Het
Acadsb A T 7: 131,443,694 T452S unknown Het
Ago2 A T 15: 73,119,466 L541Q probably damaging Het
Ap2a2 A T 7: 141,620,899 E553V probably damaging Het
Astn2 T C 4: 65,992,426 K442E unknown Het
Bicd1 A G 6: 149,513,135 T449A probably benign Het
Btn1a1 T A 13: 23,461,749 Q150L probably benign Het
C1ra G A 6: 124,522,651 G599R probably damaging Het
Camta2 T A 11: 70,671,060 Q1076L probably benign Het
Capza2 T A 6: 17,657,215 C157S probably damaging Het
Ccnk A G 12: 108,195,855 probably benign Het
Chd3 T A 11: 69,360,657 D516V probably damaging Het
Cntnap5b A G 1: 100,072,107 T197A probably benign Het
Comp A G 8: 70,376,460 N260S probably damaging Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Ddx60 T A 8: 61,940,108 probably null Het
Defb22 C T 2: 152,485,792 V158I unknown Het
Diaph3 T C 14: 86,866,513 S812G probably damaging Het
Dohh G T 10: 81,386,010 Q79H probably benign Het
Dyrk1b T G 7: 28,182,655 V147G probably benign Het
Fastkd2 C T 1: 63,748,024 T539I probably benign Het
Gm7534 G T 4: 134,202,967 T9K unknown Het
Itpr3 G A 17: 27,087,648 D229N probably damaging Het
Kif13a C A 13: 46,752,581 V1577F probably benign Het
L3mbtl4 G A 17: 68,486,943 R314H probably damaging Het
Mcoln2 A C 3: 146,192,424 N100T unknown Het
Mdh1b C T 1: 63,720,005 V143M possibly damaging Het
Mfsd4b4 G T 10: 39,892,105 Q377K probably benign Het
Mpv17l T C 16: 13,944,720 F122S probably damaging Het
Mylk T C 16: 34,922,579 S1154P probably damaging Het
Myo5b A G 18: 74,627,190 Y259C probably damaging Het
Nek1 G A 8: 61,105,612 V931M probably benign Het
Nkd2 C A 13: 73,821,318 G343V probably damaging Het
Obox8 T A 7: 14,332,003 T197S probably benign Het
Olfr1029 T C 2: 85,975,422 Y60H probably damaging Het
Olfr1029 T G 2: 85,975,741 M166R probably benign Het
Olfr1086 T A 2: 86,676,874 H153L probably benign Het
Olfr1272 A G 2: 90,282,272 F101S possibly damaging Het
Olfr16 T A 1: 172,957,177 C127* probably null Het
Olfr309 G A 7: 86,306,754 R120C probably benign Het
Olfr480 A G 7: 108,065,773 S342P probably damaging Het
Palb2 A T 7: 122,124,874 S551T probably damaging Het
Pcdha12 T A 18: 37,021,900 D557E probably damaging Het
Pcdhb21 T A 18: 37,515,868 D683E probably benign Het
Plekhb1 A G 7: 100,656,729 probably benign Het
Plekhg5 A G 4: 152,103,007 N90D probably damaging Het
Pnpla1 A G 17: 28,881,605 D482G probably benign Het
Rc3h1 A T 1: 160,940,759 probably benign Het
Rfpl4 C T 7: 5,110,540 R214H probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Setd5 T C 6: 113,115,070 I284T possibly damaging Het
Smurf1 C T 5: 144,894,087 E293K possibly damaging Het
Tas2r106 A T 6: 131,678,060 I276N probably damaging Het
Tbc1d2 C A 4: 46,649,791 A82S possibly damaging Het
Tex19.2 A G 11: 121,117,184 I146T possibly damaging Het
Tmem107 T G 11: 69,071,455 N79K probably damaging Het
Tpsab1 A T 17: 25,345,331 S50T probably benign Het
Ttn T A 2: 76,723,250 K31008* probably null Het
Ubox5 T C 2: 130,599,709 T353A probably benign Het
Usp24 T A 4: 106,428,514 H2445Q probably damaging Het
Uvrag T C 7: 98,888,491 D499G probably benign Het
Xndc1 A T 7: 102,079,136 N247I possibly damaging Het
Yipf2 A T 9: 21,589,995 W226R probably damaging Het
Zfp335 T A 2: 164,898,053 Q793L probably damaging Het
Zfp385c A G 11: 100,657,465 S54P probably damaging Het
Other mutations in Kcnv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Kcnv1 APN 15 45113228 missense probably benign 0.00
IGL02227:Kcnv1 APN 15 45114274 missense probably damaging 1.00
IGL02472:Kcnv1 APN 15 45109123 nonsense probably null
IGL03239:Kcnv1 APN 15 45109490 splice site probably benign
R0079:Kcnv1 UTSW 15 45113333 missense probably damaging 1.00
R0534:Kcnv1 UTSW 15 45109249 missense probably damaging 0.98
R0627:Kcnv1 UTSW 15 45112881 splice site probably benign
R1614:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R1615:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R2942:Kcnv1 UTSW 15 45109185 missense probably damaging 1.00
R4244:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4290:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4291:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4293:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4294:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4295:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4335:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4342:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4345:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4354:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4934:Kcnv1 UTSW 15 45109248 missense probably damaging 1.00
R5240:Kcnv1 UTSW 15 45113244 missense probably damaging 1.00
R5295:Kcnv1 UTSW 15 45114591 missense unknown
R5631:Kcnv1 UTSW 15 45109357 missense probably damaging 1.00
R5669:Kcnv1 UTSW 15 45114252 missense possibly damaging 0.71
R5762:Kcnv1 UTSW 15 45109122 missense probably damaging 0.99
R5776:Kcnv1 UTSW 15 45114567 missense unknown
R5787:Kcnv1 UTSW 15 45114330 missense probably damaging 1.00
R5980:Kcnv1 UTSW 15 45109414 missense probably damaging 0.99
R6819:Kcnv1 UTSW 15 45109117 missense probably damaging 0.99
R6851:Kcnv1 UTSW 15 45109198 missense probably damaging 1.00
R6997:Kcnv1 UTSW 15 45114601 missense unknown
R7254:Kcnv1 UTSW 15 45113208 missense probably benign 0.00
R7258:Kcnv1 UTSW 15 45109315 missense probably damaging 0.99
R7272:Kcnv1 UTSW 15 45113180 missense probably benign 0.00
R7367:Kcnv1 UTSW 15 45109242 missense probably damaging 1.00
R7995:Kcnv1 UTSW 15 45109347 missense probably damaging 1.00
R8725:Kcnv1 UTSW 15 45114603 missense unknown
R8727:Kcnv1 UTSW 15 45114603 missense unknown
R8730:Kcnv1 UTSW 15 45109401 missense probably damaging 0.99
R8754:Kcnv1 UTSW 15 45114469 nonsense probably null
X0026:Kcnv1 UTSW 15 45109467 missense possibly damaging 0.69
Z1177:Kcnv1 UTSW 15 45114435 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTCTTGAGAGCTTCACGC -3'
(R):5'- GCTGAAGAAGAATGCTTATGCCTG -3'

Sequencing Primer
(F):5'- TTGAGTTTCAAGGTGAAGTAGCAAGC -3'
(R):5'- GAATGCTTATGCCTGACAGC -3'
Posted On2020-07-28