Incidental Mutation 'R8272:Myh7b'
ID637763
Institutional Source Beutler Lab
Gene Symbol Myh7b
Ensembl Gene ENSMUSG00000074652
Gene Namemyosin, heavy chain 7B, cardiac muscle, beta
SynonymsMyh14
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8272 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location155611212-155634307 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 155632904 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 1787 (E1787D)
Ref Sequence ENSEMBL: ENSMUSP00000090672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041059] [ENSMUST00000092995] [ENSMUST00000103140]
Predicted Effect probably benign
Transcript: ENSMUST00000041059
SMART Domains Protein: ENSMUSP00000037574
Gene: ENSMUSG00000038324

DomainStartEndE-ValueType
low complexity region 2 35 N/A INTRINSIC
low complexity region 38 53 N/A INTRINSIC
Pfam:DUF3689 407 714 5.2e-135 PFAM
low complexity region 724 735 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092995
AA Change: E1787D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000090672
Gene: ENSMUSG00000074652
AA Change: E1787D

DomainStartEndE-ValueType
Pfam:Myosin_N 32 72 4.7e-14 PFAM
MYSc 78 786 N/A SMART
IQ 787 809 2.6e0 SMART
Pfam:Myosin_tail_1 850 1931 5.5e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103140
SMART Domains Protein: ENSMUSP00000099429
Gene: ENSMUSG00000038324

DomainStartEndE-ValueType
low complexity region 2 35 N/A INTRINSIC
low complexity region 38 53 N/A INTRINSIC
Pfam:DUF3689 399 710 1.1e-138 PFAM
low complexity region 716 727 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a myosin heavy chain. The encoded protein forms a hexamer comprised of two heavy chains, two alkali light chains, and two regulatory light chain components. This complex functions in muscle contraction. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931422A03Rik G A 2: 104,026,154 R21C unknown Het
4933407L21Rik G T 1: 85,931,397 E90* probably null Het
Abca15 A G 7: 120,407,442 Y1643C probably damaging Het
Adtrp G T 13: 41,816,154 A123D probably damaging Het
Asmt A T X: 170,672,725 D20V possibly damaging Het
BC067074 A T 13: 113,368,355 D1979V Het
Bid T C 6: 120,900,215 E55G probably damaging Het
Brd3 A G 2: 27,461,713 V176A probably benign Het
Btnl2 G T 17: 34,356,301 probably null Het
Card11 A G 5: 140,890,039 S562P probably damaging Het
Casp8 T G 1: 58,833,742 M259R probably damaging Het
Ccin G A 4: 43,984,064 R157H probably damaging Het
Cfap45 G A 1: 172,527,839 R18Q possibly damaging Het
Chuk A G 19: 44,103,736 I41T possibly damaging Het
Col28a1 G A 6: 8,154,175 P333L possibly damaging Het
Ctnna3 T G 10: 65,002,598 V818G probably damaging Het
Cyp4f18 G T 8: 71,989,091 L456M probably benign Het
Ddx50 A G 10: 62,621,477 V598A probably benign Het
Dhrs7b C A 11: 60,851,754 Q91K probably benign Het
Dnah11 T A 12: 118,111,017 T1367S probably benign Het
Fam98b T A 2: 117,262,854 C183S probably benign Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Fbxw15 A C 9: 109,559,760 S194A probably benign Het
Flrt3 G T 2: 140,660,697 P337Q probably damaging Het
Gm12695 A G 4: 96,723,946 Y527H possibly damaging Het
Gramd1b T C 9: 40,304,524 T677A probably benign Het
Grm8 A T 6: 27,363,282 S745T probably damaging Het
Kctd8 T C 5: 69,110,460 K436E probably benign Het
Klf5 G T 14: 99,302,104 A318S possibly damaging Het
L3mbtl3 C T 10: 26,303,668 V505M unknown Het
Letm2 A G 8: 25,586,656 L310P probably damaging Het
Lrrc16a T G 13: 24,036,579 H1054P probably benign Het
Lrrc4 T C 6: 28,662,193 H174R unknown Het
Myh11 T C 16: 14,218,854 S995G Het
Myoc T C 1: 162,639,426 S55P probably benign Het
Naaladl2 T C 3: 24,058,202 Q572R probably damaging Het
Nanog T A 6: 122,711,777 S131T probably benign Het
Nifk A G 1: 118,332,404 K230E probably benign Het
Nlrp10 A G 7: 108,925,896 S126P probably benign Het
Npc1l1 T A 11: 6,229,327 K28* probably null Het
Olfr1454 G A 19: 13,063,431 V7M possibly damaging Het
Olfr451-ps1 A G 6: 42,801,104 D121G probably damaging Het
Pcdhac2 T A 18: 37,146,189 C741S probably benign Het
Pcx A T 19: 4,601,730 N45I probably damaging Het
Peak1 A G 9: 56,258,898 V582A probably damaging Het
Plcxd3 G T 15: 4,516,736 R74L probably damaging Het
Ptpn21 G A 12: 98,688,530 A726V probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rimbp3 T C 16: 17,209,105 V131A possibly damaging Het
Rrp1b A G 17: 32,057,189 K570R probably benign Het
Serpinb1a A T 13: 32,845,737 F167L probably damaging Het
Slc12a1 T C 2: 125,228,816 L1076S probably damaging Het
Sspo A T 6: 48,448,519 T25S probably benign Het
Syvn1 G A 19: 6,047,941 R3H probably damaging Het
Tead2 A G 7: 45,228,742 E280G probably benign Het
Tmem263 T A 10: 85,114,567 V74E possibly damaging Het
Tmem38b T A 4: 53,854,332 L188Q probably damaging Het
Tmod4 C T 3: 95,125,860 T55I probably damaging Het
Tmprss12 A T 15: 100,282,265 E62V probably benign Het
Trim27 G A 13: 21,180,610 C39Y probably benign Het
Vmn2r110 A G 17: 20,596,228 L11S probably damaging Het
Vmn2r125 A G 4: 156,350,078 Y53C probably damaging Het
Vmn2r65 A T 7: 84,947,609 F79L probably benign Het
Vps13a A G 19: 16,749,845 probably null Het
Zdbf2 A G 1: 63,305,983 T1174A probably benign Het
Zfhx4 T G 3: 5,243,867 S718A probably damaging Het
Zfp78 A G 7: 6,373,214 T41A probably benign Het
Other mutations in Myh7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Myh7b APN 2 155630292 missense probably damaging 0.99
IGL01604:Myh7b APN 2 155632407 missense probably damaging 0.96
IGL02179:Myh7b APN 2 155614491 missense probably benign 0.02
IGL02729:Myh7b APN 2 155625689 missense probably damaging 1.00
IGL02804:Myh7b APN 2 155625723 missense probably damaging 1.00
IGL02851:Myh7b APN 2 155628827 missense probably damaging 1.00
IGL02956:Myh7b APN 2 155632903 missense probably damaging 1.00
IGL02956:Myh7b APN 2 155625954 missense possibly damaging 0.95
IGL02992:Myh7b APN 2 155621410 missense probably damaging 0.99
IGL03060:Myh7b APN 2 155632751 missense probably damaging 1.00
IGL03061:Myh7b APN 2 155620111 missense possibly damaging 0.93
IGL03226:Myh7b APN 2 155620483 nonsense probably null
IGL03246:Myh7b APN 2 155617872 missense probably damaging 1.00
IGL03382:Myh7b APN 2 155623479 missense probably damaging 1.00
euclidian UTSW 2 155633399 missense probably benign 0.32
imaginary UTSW 2 155632255 missense probably benign 0.36
Irrational UTSW 2 155630672 unclassified probably benign
Muscoli UTSW 2 155620118 nonsense probably null
R0015:Myh7b UTSW 2 155622286 missense probably damaging 1.00
R0015:Myh7b UTSW 2 155622286 missense probably damaging 1.00
R0109:Myh7b UTSW 2 155611674 missense possibly damaging 0.92
R0309:Myh7b UTSW 2 155630672 unclassified probably benign
R0567:Myh7b UTSW 2 155626398 missense probably damaging 1.00
R0619:Myh7b UTSW 2 155611722 missense probably benign 0.00
R0927:Myh7b UTSW 2 155620120 missense probably damaging 1.00
R0973:Myh7b UTSW 2 155620427 missense probably benign
R0973:Myh7b UTSW 2 155620427 missense probably benign
R0974:Myh7b UTSW 2 155620427 missense probably benign
R1137:Myh7b UTSW 2 155622714 missense probably damaging 1.00
R1261:Myh7b UTSW 2 155621083 missense probably benign 0.00
R1268:Myh7b UTSW 2 155614046 nonsense probably null
R1537:Myh7b UTSW 2 155631787 missense probably damaging 0.96
R1632:Myh7b UTSW 2 155620525 missense probably benign 0.04
R1694:Myh7b UTSW 2 155613193 missense probably damaging 0.99
R1697:Myh7b UTSW 2 155620134 missense probably damaging 1.00
R1730:Myh7b UTSW 2 155625672 missense possibly damaging 0.73
R1762:Myh7b UTSW 2 155630858 missense probably damaging 0.96
R1783:Myh7b UTSW 2 155625672 missense possibly damaging 0.73
R2105:Myh7b UTSW 2 155629457 missense probably benign 0.00
R2140:Myh7b UTSW 2 155620123 missense probably damaging 1.00
R2971:Myh7b UTSW 2 155632255 missense probably benign 0.36
R3838:Myh7b UTSW 2 155632989 missense probably damaging 1.00
R4074:Myh7b UTSW 2 155618758 missense probably damaging 0.96
R4191:Myh7b UTSW 2 155633399 missense probably benign 0.32
R4689:Myh7b UTSW 2 155630514 missense possibly damaging 0.75
R4695:Myh7b UTSW 2 155614177 missense probably damaging 1.00
R4697:Myh7b UTSW 2 155629322 missense probably damaging 1.00
R4771:Myh7b UTSW 2 155626394 nonsense probably null
R4794:Myh7b UTSW 2 155623266 missense probably benign 0.00
R4842:Myh7b UTSW 2 155633989 missense probably benign 0.45
R4871:Myh7b UTSW 2 155613500 missense probably benign 0.18
R5022:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5023:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5025:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5050:Myh7b UTSW 2 155631750 missense probably benign 0.00
R5055:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5056:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5161:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5284:Myh7b UTSW 2 155632314 missense probably benign
R5422:Myh7b UTSW 2 155631034 missense probably damaging 0.99
R5505:Myh7b UTSW 2 155632672 missense probably benign 0.01
R5946:Myh7b UTSW 2 155621395 missense probably damaging 1.00
R6089:Myh7b UTSW 2 155622489 missense probably damaging 1.00
R6103:Myh7b UTSW 2 155618743 missense probably damaging 1.00
R6233:Myh7b UTSW 2 155631799 missense possibly damaging 0.85
R6292:Myh7b UTSW 2 155632396 missense probably damaging 1.00
R6350:Myh7b UTSW 2 155628760 missense probably benign 0.00
R6484:Myh7b UTSW 2 155628643 missense probably benign 0.05
R6760:Myh7b UTSW 2 155620118 nonsense probably null
R6896:Myh7b UTSW 2 155622568 critical splice donor site probably null
R6945:Myh7b UTSW 2 155622232 missense possibly damaging 0.95
R7020:Myh7b UTSW 2 155631751 missense possibly damaging 0.56
R7052:Myh7b UTSW 2 155614133 missense probably damaging 1.00
R7102:Myh7b UTSW 2 155622199 missense probably damaging 1.00
R7248:Myh7b UTSW 2 155622186 missense probably damaging 1.00
R7303:Myh7b UTSW 2 155618740 missense probably damaging 1.00
R7360:Myh7b UTSW 2 155632540 missense probably benign 0.38
R7652:Myh7b UTSW 2 155632236 missense probably damaging 0.99
R7678:Myh7b UTSW 2 155617778 splice site probably null
R7703:Myh7b UTSW 2 155620436 missense probably null 1.00
R7711:Myh7b UTSW 2 155620403 missense probably damaging 1.00
R7923:Myh7b UTSW 2 155625966 missense probably benign
R7967:Myh7b UTSW 2 155614199 splice site probably null
R8045:Myh7b UTSW 2 155613181 missense probably benign 0.00
R8176:Myh7b UTSW 2 155625966 missense probably benign 0.06
X0013:Myh7b UTSW 2 155631169 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGATGCGCCAAAGATGTTAC -3'
(R):5'- TGGTACACGAGCTCCTTGAC -3'

Sequencing Primer
(F):5'- ACTTGGCCCAGCTGAGTG -3'
(R):5'- GTTTACGCACCCCCTTGAGG -3'
Posted On2020-07-28