Incidental Mutation 'R0726:Sntb1'
ID63778
Institutional Source Beutler Lab
Gene Symbol Sntb1
Ensembl Gene ENSMUSG00000060429
Gene Namesyntrophin, basic 1
Synonyms59-1 DAP, beta1-Syntrophin
MMRRC Submission 038908-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R0726 (G1)
Quality Score172
Status Validated
Chromosome15
Chromosomal Location55636388-55906949 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55676356 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 361 (R361G)
Ref Sequence ENSEMBL: ENSMUSP00000041294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039769]
Predicted Effect probably benign
Transcript: ENSMUST00000039769
AA Change: R361G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041294
Gene: ENSMUSG00000060429
AA Change: R361G

DomainStartEndE-ValueType
PH 19 299 5.14e0 SMART
PDZ 120 194 4.5e-17 SMART
PH 322 434 2.81e-8 SMART
Meta Mutation Damage Score 0.0632 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.1%
  • 20x: 89.2%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dystrophin is a large, rod-like cytoskeletal protein found at the inner surface of muscle fibers. Dystrophin is missing in Duchenne Muscular Dystrophy patients and is present in reduced amounts in Becker Muscular Dystrophy patients. The protein encoded by this gene is a peripheral membrane protein found associated with dystrophin and dystrophin-related proteins. This gene is a member of the syntrophin gene family, which contains at least two other structurally-related genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg12 T C 15: 88,806,647 Y256C probably damaging Het
Alox15 T A 11: 70,350,195 D160V probably damaging Het
Aox2 T C 1: 58,334,782 probably benign Het
Bbs9 G T 9: 22,793,823 A729S probably damaging Het
Bmp2k T A 5: 97,087,494 probably benign Het
Braf C T 6: 39,662,148 R223Q possibly damaging Het
Cd101 A T 3: 101,020,622 S48T possibly damaging Het
Cdh9 T G 15: 16,831,044 D322E probably benign Het
Col28a1 C T 6: 8,014,495 probably null Het
Cpxm1 G A 2: 130,390,939 R712W probably damaging Het
Csnk1g1 T C 9: 66,032,355 probably benign Het
Cyp2d37-ps A C 15: 82,690,449 noncoding transcript Het
Cyth3 T C 5: 143,692,642 V115A probably benign Het
Dnah9 C T 11: 65,965,681 V2885M probably damaging Het
Dock9 G T 14: 121,651,768 Y326* probably null Het
Espl1 T C 15: 102,322,598 I1844T probably benign Het
Fam105a A T 15: 27,656,947 I338N probably damaging Het
Fam20a T A 11: 109,677,194 N357Y probably damaging Het
Fancc C A 13: 63,323,411 R385L probably benign Het
Foxe3 A T 4: 114,925,250 L255H unknown Het
Frem2 T C 3: 53,519,626 D2967G possibly damaging Het
Gabra6 T G 11: 42,315,127 T301P probably damaging Het
Ganab T A 19: 8,911,113 Y511N probably damaging Het
Gm498 A G 7: 143,871,761 D49G probably damaging Het
Grm4 T A 17: 27,438,438 probably benign Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Kcnj9 G A 1: 172,325,921 S212F probably damaging Het
Kif15 C A 9: 122,959,928 H62N probably benign Het
Kptn A G 7: 16,120,722 D106G probably damaging Het
Krtap13-1 T A 16: 88,729,304 S139T probably damaging Het
Lepr C A 4: 101,764,934 N354K probably benign Het
Lypd3 G T 7: 24,638,544 E112* probably null Het
Med13l A T 5: 118,748,684 N1550I probably damaging Het
Mettl2 C T 11: 105,126,844 P60L probably benign Het
Muc4 A G 16: 32,769,827 E850G probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Nek1 A G 8: 61,089,592 R739G probably damaging Het
Nipbl A T 15: 8,351,555 D584E probably benign Het
Nkain3 C T 4: 20,158,388 V162M possibly damaging Het
Nmrk1 T C 19: 18,641,480 probably benign Het
Nsd2 T C 5: 33,861,028 probably benign Het
Olfr1198 A T 2: 88,746,008 N293K probably benign Het
Olfr1270 T A 2: 90,149,283 H241L probably damaging Het
Olfr133 T C 17: 38,148,624 F12S probably damaging Het
Olfr1449 T A 19: 12,935,605 V289D probably damaging Het
Olfr907 T A 9: 38,499,122 M151K possibly damaging Het
Phex T A X: 157,372,561 probably benign Het
Pip5k1b G T 19: 24,378,892 D227E probably damaging Het
Prdm13 A G 4: 21,683,914 I119T unknown Het
Rab19 G T 6: 39,383,959 V14L probably benign Het
Rasa3 A G 8: 13,580,118 probably benign Het
Rgsl1 C T 1: 153,802,328 S118N probably damaging Het
Rif1 C T 2: 52,110,353 T1273M possibly damaging Het
Scn8a A G 15: 100,972,830 N254S probably damaging Het
Sema6a T C 18: 47,291,981 T188A probably damaging Het
Sh3pxd2a C T 19: 47,268,762 E506K probably damaging Het
Smarca2 A T 19: 26,698,403 K1014N probably damaging Het
Smarca4 T G 9: 21,700,139 probably null Het
Soga1 G T 2: 157,060,262 R278S probably damaging Het
Stx5a T A 19: 8,754,911 I208N probably damaging Het
Tas2r102 T A 6: 132,762,452 W108R probably damaging Het
Tcl1 A G 12: 105,218,670 Y94H probably damaging Het
Tenm3 T A 8: 48,236,594 Y1986F probably damaging Het
Tet2 G A 3: 133,468,184 P1439L probably benign Het
Tiam2 T C 17: 3,512,833 probably benign Het
Ubap2l G A 3: 90,021,246 T526M probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uhrf1bp1 T C 17: 27,885,489 V503A possibly damaging Het
Ushbp1 T A 8: 71,388,747 probably benign Het
Usp28 C T 9: 49,003,869 R115C probably damaging Het
Vldlr A T 19: 27,238,386 D261V probably damaging Het
Vmn2r5 C T 3: 64,503,765 D461N probably benign Het
Vmn2r86 A T 10: 130,446,396 F784I probably damaging Het
Zfp59 A T 7: 27,854,088 I322F probably damaging Het
Zfp607a A T 7: 27,879,149 H548L probably benign Het
Zfp626 G A 7: 27,818,623 C343Y probably damaging Het
Other mutations in Sntb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02056:Sntb1 APN 15 55648039 missense possibly damaging 0.93
IGL02732:Sntb1 APN 15 55792200 missense possibly damaging 0.62
IGL02965:Sntb1 APN 15 55642685 nonsense probably null
IGL03084:Sntb1 APN 15 55792091 missense probably damaging 0.99
IGL03286:Sntb1 APN 15 55792046 missense possibly damaging 0.59
R0117:Sntb1 UTSW 15 55906353 missense probably benign
R0178:Sntb1 UTSW 15 55906144 missense probably damaging 0.98
R0465:Sntb1 UTSW 15 55749276 missense probably benign 0.02
R0626:Sntb1 UTSW 15 55642783 missense probably benign 0.20
R1125:Sntb1 UTSW 15 55749280 missense probably benign
R1443:Sntb1 UTSW 15 55647955 missense probably damaging 1.00
R1888:Sntb1 UTSW 15 55749349 nonsense probably null
R1888:Sntb1 UTSW 15 55749349 nonsense probably null
R2208:Sntb1 UTSW 15 55906318 missense possibly damaging 0.79
R2426:Sntb1 UTSW 15 55906179 missense probably damaging 1.00
R3721:Sntb1 UTSW 15 55642818 missense probably benign 0.10
R4370:Sntb1 UTSW 15 55792091 missense probably damaging 0.99
R4706:Sntb1 UTSW 15 55749274 missense probably benign 0.09
R4883:Sntb1 UTSW 15 55642802 nonsense probably null
R5223:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5242:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5270:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5313:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5314:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5316:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5336:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5337:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5396:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5398:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5427:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5428:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5429:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5431:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5594:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5658:Sntb1 UTSW 15 55792076 missense probably damaging 1.00
R5665:Sntb1 UTSW 15 55792139 missense probably benign 0.00
R6147:Sntb1 UTSW 15 55648010 missense probably benign
R6159:Sntb1 UTSW 15 55676302 critical splice donor site probably null
R6883:Sntb1 UTSW 15 55906323 missense probably benign 0.38
R7008:Sntb1 UTSW 15 55792072 nonsense probably null
R7168:Sntb1 UTSW 15 55791265 missense probably benign 0.00
R7511:Sntb1 UTSW 15 55647951 missense possibly damaging 0.71
R7600:Sntb1 UTSW 15 55792188 missense possibly damaging 0.82
R8242:Sntb1 UTSW 15 55792233 missense possibly damaging 0.95
R8804:Sntb1 UTSW 15 55792127 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- AGCCCCTGCCATACCTTTAGACAG -3'
(R):5'- GCACTGACTCTCCCAAGCATTTGC -3'

Sequencing Primer
(F):5'- CCTTTAGACAGCACTAGAGTGTG -3'
(R):5'- ACTGTTGAAGCCTGAACCG -3'
Posted On2013-07-30