Incidental Mutation 'R8272:Nlrp10'
ID637783
Institutional Source Beutler Lab
Gene Symbol Nlrp10
Ensembl Gene ENSMUSG00000049709
Gene NameNLR family, pyrin domain containing 10
SynonymsNalp10, 6430548I20Rik, Pynod
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8272 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location108921852-108930178 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108925896 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 126 (S126P)
Ref Sequence ENSEMBL: ENSMUSP00000050252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055745]
PDB Structure Solution structure of the Pyrin/PAAD-DAPIN domain in mouse NALP10 (NACHT, leucine rich repeat and PYD containing 10) [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000055745
AA Change: S126P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000050252
Gene: ENSMUSG00000049709
AA Change: S126P

DomainStartEndE-ValueType
PYRIN 9 88 4.13e-18 SMART
low complexity region 126 137 N/A INTRINSIC
AAA 161 302 1.07e-2 SMART
low complexity region 576 597 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the NALP protein family typically contain a NACHT domain, a NACHT-associated domain (NAD), a C-terminal leucine-rich repeat (LRR) region, and an N-terminal pyrin domain (PYD). The protein encoded by this gene belongs to the NALP protein family despite lacking the LRR region. This protein likely plays a regulatory role in the innate immune system. The protein belongs to the signal-induced multiprotein complex, the inflammasome, that activates the pro-inflammatory caspases, caspase-1 and caspase-5. Other experiments indicate that this gene acts as a multifunctional negative regulator of inflammation and apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display a global defect in adaptive immune responses with impaired dendritic cell migration to lymph nodes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931422A03Rik G A 2: 104,026,154 R21C unknown Het
4933407L21Rik G T 1: 85,931,397 E90* probably null Het
Abca15 A G 7: 120,407,442 Y1643C probably damaging Het
Adtrp G T 13: 41,816,154 A123D probably damaging Het
Asmt A T X: 170,672,725 D20V possibly damaging Het
BC067074 A T 13: 113,368,355 D1979V Het
Bid T C 6: 120,900,215 E55G probably damaging Het
Brd3 A G 2: 27,461,713 V176A probably benign Het
Btnl2 G T 17: 34,356,301 probably null Het
Card11 A G 5: 140,890,039 S562P probably damaging Het
Casp8 T G 1: 58,833,742 M259R probably damaging Het
Ccin G A 4: 43,984,064 R157H probably damaging Het
Cfap45 G A 1: 172,527,839 R18Q possibly damaging Het
Chuk A G 19: 44,103,736 I41T possibly damaging Het
Col28a1 G A 6: 8,154,175 P333L possibly damaging Het
Ctnna3 T G 10: 65,002,598 V818G probably damaging Het
Cyp4f18 G T 8: 71,989,091 L456M probably benign Het
Ddx50 A G 10: 62,621,477 V598A probably benign Het
Dhrs7b C A 11: 60,851,754 Q91K probably benign Het
Dnah11 T A 12: 118,111,017 T1367S probably benign Het
Fam98b T A 2: 117,262,854 C183S probably benign Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Fbxw15 A C 9: 109,559,760 S194A probably benign Het
Flrt3 G T 2: 140,660,697 P337Q probably damaging Het
Gm12695 A G 4: 96,723,946 Y527H possibly damaging Het
Gramd1b T C 9: 40,304,524 T677A probably benign Het
Grm8 A T 6: 27,363,282 S745T probably damaging Het
Kctd8 T C 5: 69,110,460 K436E probably benign Het
Klf5 G T 14: 99,302,104 A318S possibly damaging Het
L3mbtl3 C T 10: 26,303,668 V505M unknown Het
Letm2 A G 8: 25,586,656 L310P probably damaging Het
Lrrc16a T G 13: 24,036,579 H1054P probably benign Het
Lrrc4 T C 6: 28,662,193 H174R unknown Het
Myh11 T C 16: 14,218,854 S995G Het
Myh7b A T 2: 155,632,904 E1787D probably damaging Het
Myoc T C 1: 162,639,426 S55P probably benign Het
Naaladl2 T C 3: 24,058,202 Q572R probably damaging Het
Nanog T A 6: 122,711,777 S131T probably benign Het
Nifk A G 1: 118,332,404 K230E probably benign Het
Npc1l1 T A 11: 6,229,327 K28* probably null Het
Olfr1454 G A 19: 13,063,431 V7M possibly damaging Het
Olfr451-ps1 A G 6: 42,801,104 D121G probably damaging Het
Pcdhac2 T A 18: 37,146,189 C741S probably benign Het
Pcx A T 19: 4,601,730 N45I probably damaging Het
Peak1 A G 9: 56,258,898 V582A probably damaging Het
Plcxd3 G T 15: 4,516,736 R74L probably damaging Het
Ptpn21 G A 12: 98,688,530 A726V probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rimbp3 T C 16: 17,209,105 V131A possibly damaging Het
Rrp1b A G 17: 32,057,189 K570R probably benign Het
Serpinb1a A T 13: 32,845,737 F167L probably damaging Het
Slc12a1 T C 2: 125,228,816 L1076S probably damaging Het
Sspo A T 6: 48,448,519 T25S probably benign Het
Syvn1 G A 19: 6,047,941 R3H probably damaging Het
Tead2 A G 7: 45,228,742 E280G probably benign Het
Tmem263 T A 10: 85,114,567 V74E possibly damaging Het
Tmem38b T A 4: 53,854,332 L188Q probably damaging Het
Tmod4 C T 3: 95,125,860 T55I probably damaging Het
Tmprss12 A T 15: 100,282,265 E62V probably benign Het
Trim27 G A 13: 21,180,610 C39Y probably benign Het
Vmn2r110 A G 17: 20,596,228 L11S probably damaging Het
Vmn2r125 A G 4: 156,350,078 Y53C probably damaging Het
Vmn2r65 A T 7: 84,947,609 F79L probably benign Het
Vps13a A G 19: 16,749,845 probably null Het
Zdbf2 A G 1: 63,305,983 T1174A probably benign Het
Zfhx4 T G 3: 5,243,867 S718A probably damaging Het
Zfp78 A G 7: 6,373,214 T41A probably benign Het
Other mutations in Nlrp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Nlrp10 APN 7 108924581 missense possibly damaging 0.86
IGL01482:Nlrp10 APN 7 108926952 missense probably benign
IGL02043:Nlrp10 APN 7 108925502 missense probably damaging 0.99
IGL03129:Nlrp10 APN 7 108924911 missense probably damaging 1.00
IGL02835:Nlrp10 UTSW 7 108924662 missense possibly damaging 0.61
R0106:Nlrp10 UTSW 7 108925322 missense possibly damaging 0.94
R0106:Nlrp10 UTSW 7 108925322 missense possibly damaging 0.94
R0540:Nlrp10 UTSW 7 108924285 missense probably benign 0.26
R0607:Nlrp10 UTSW 7 108924285 missense probably benign 0.26
R1166:Nlrp10 UTSW 7 108925010 missense probably damaging 1.00
R1248:Nlrp10 UTSW 7 108925881 missense probably benign 0.08
R1450:Nlrp10 UTSW 7 108925388 missense probably damaging 0.98
R1459:Nlrp10 UTSW 7 108924348 missense probably benign
R1567:Nlrp10 UTSW 7 108927050 missense probably benign 0.02
R1635:Nlrp10 UTSW 7 108924530 missense possibly damaging 0.93
R1845:Nlrp10 UTSW 7 108927041 missense probably damaging 1.00
R1912:Nlrp10 UTSW 7 108925395 nonsense probably null
R1952:Nlrp10 UTSW 7 108924563 missense probably benign 0.20
R1953:Nlrp10 UTSW 7 108925118 missense probably benign 0.00
R2079:Nlrp10 UTSW 7 108925628 missense possibly damaging 0.66
R3615:Nlrp10 UTSW 7 108924476 missense probably benign
R3616:Nlrp10 UTSW 7 108924476 missense probably benign
R4207:Nlrp10 UTSW 7 108924341 missense possibly damaging 0.56
R4786:Nlrp10 UTSW 7 108925238 missense probably damaging 1.00
R5048:Nlrp10 UTSW 7 108924565 missense probably benign 0.01
R5568:Nlrp10 UTSW 7 108924261 missense probably benign 0.00
R5993:Nlrp10 UTSW 7 108927013 missense probably benign 0.00
R6033:Nlrp10 UTSW 7 108924577 missense probably benign 0.17
R6033:Nlrp10 UTSW 7 108924577 missense probably benign 0.17
R6170:Nlrp10 UTSW 7 108924464 missense probably benign 0.00
R6320:Nlrp10 UTSW 7 108925746 missense possibly damaging 0.82
R6935:Nlrp10 UTSW 7 108926900 missense probably damaging 0.99
R7024:Nlrp10 UTSW 7 108925198 missense possibly damaging 0.73
R7081:Nlrp10 UTSW 7 108924648 missense probably benign 0.02
R7397:Nlrp10 UTSW 7 108924692 missense probably damaging 1.00
R7720:Nlrp10 UTSW 7 108924488 missense probably benign 0.36
R7763:Nlrp10 UTSW 7 108925826 missense probably damaging 0.99
R7776:Nlrp10 UTSW 7 108925449 missense probably damaging 1.00
R7823:Nlrp10 UTSW 7 108924261 missense probably benign 0.00
R7852:Nlrp10 UTSW 7 108925074 missense probably damaging 1.00
Z1177:Nlrp10 UTSW 7 108925851 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACATAATCAAACTGGCCTGGG -3'
(R):5'- GGCAATCTCAGGGTTTGAAGG -3'

Sequencing Primer
(F):5'- TAATCAAACTGGCCTGGGTACAGC -3'
(R):5'- CAGGGTTTGAAGGGTTGATTTTTGC -3'
Posted On2020-07-28