Incidental Mutation 'R8272:Ctnna3'
ID637793
Institutional Source Beutler Lab
Gene Symbol Ctnna3
Ensembl Gene ENSMUSG00000060843
Gene Namecatenin (cadherin associated protein), alpha 3
SynonymsCatna3, Vr22, alphaT-catenin, 4930429L08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R8272 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location63430098-65003667 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 65002598 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 818 (V818G)
Ref Sequence ENSEMBL: ENSMUSP00000101081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075099] [ENSMUST00000105440] [ENSMUST00000105441]
Predicted Effect probably damaging
Transcript: ENSMUST00000075099
AA Change: V818G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074606
Gene: ENSMUSG00000060843
AA Change: V818G

DomainStartEndE-ValueType
Pfam:Vinculin 17 363 5.1e-66 PFAM
Pfam:Vinculin 324 856 1e-175 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105440
AA Change: V818G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101080
Gene: ENSMUSG00000060843
AA Change: V818G

DomainStartEndE-ValueType
Pfam:Vinculin 17 363 5.1e-66 PFAM
Pfam:Vinculin 324 856 1e-175 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105441
AA Change: V818G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101081
Gene: ENSMUSG00000060843
AA Change: V818G

DomainStartEndE-ValueType
Pfam:Vinculin 17 363 5.1e-66 PFAM
Pfam:Vinculin 324 856 1e-175 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the vinculin/alpha-catenin family. The encoded protein plays a role in cell-cell adhesion in muscle cells. Mutations in this gene are associated with arrhythmogenic right ventricular dysplasia, familial 13. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased heart weight, increased ventricle size, dilated cardiomyopathy and increased susceptibility to ischemia-induced arrhythmias and mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931422A03Rik G A 2: 104,026,154 R21C unknown Het
4933407L21Rik G T 1: 85,931,397 E90* probably null Het
Abca15 A G 7: 120,407,442 Y1643C probably damaging Het
Adtrp G T 13: 41,816,154 A123D probably damaging Het
Asmt A T X: 170,672,725 D20V possibly damaging Het
BC067074 A T 13: 113,368,355 D1979V Het
Bid T C 6: 120,900,215 E55G probably damaging Het
Brd3 A G 2: 27,461,713 V176A probably benign Het
Btnl2 G T 17: 34,356,301 probably null Het
Card11 A G 5: 140,890,039 S562P probably damaging Het
Casp8 T G 1: 58,833,742 M259R probably damaging Het
Ccin G A 4: 43,984,064 R157H probably damaging Het
Cfap45 G A 1: 172,527,839 R18Q possibly damaging Het
Chuk A G 19: 44,103,736 I41T possibly damaging Het
Col28a1 G A 6: 8,154,175 P333L possibly damaging Het
Cyp4f18 G T 8: 71,989,091 L456M probably benign Het
Ddx50 A G 10: 62,621,477 V598A probably benign Het
Dhrs7b C A 11: 60,851,754 Q91K probably benign Het
Dnah11 T A 12: 118,111,017 T1367S probably benign Het
Fam98b T A 2: 117,262,854 C183S probably benign Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Fbxw15 A C 9: 109,559,760 S194A probably benign Het
Flrt3 G T 2: 140,660,697 P337Q probably damaging Het
Gm12695 A G 4: 96,723,946 Y527H possibly damaging Het
Gramd1b T C 9: 40,304,524 T677A probably benign Het
Grm8 A T 6: 27,363,282 S745T probably damaging Het
Kctd8 T C 5: 69,110,460 K436E probably benign Het
Klf5 G T 14: 99,302,104 A318S possibly damaging Het
L3mbtl3 C T 10: 26,303,668 V505M unknown Het
Letm2 A G 8: 25,586,656 L310P probably damaging Het
Lrrc16a T G 13: 24,036,579 H1054P probably benign Het
Lrrc4 T C 6: 28,662,193 H174R unknown Het
Myh11 T C 16: 14,218,854 S995G Het
Myh7b A T 2: 155,632,904 E1787D probably damaging Het
Myoc T C 1: 162,639,426 S55P probably benign Het
Naaladl2 T C 3: 24,058,202 Q572R probably damaging Het
Nanog T A 6: 122,711,777 S131T probably benign Het
Nifk A G 1: 118,332,404 K230E probably benign Het
Nlrp10 A G 7: 108,925,896 S126P probably benign Het
Npc1l1 T A 11: 6,229,327 K28* probably null Het
Olfr1454 G A 19: 13,063,431 V7M possibly damaging Het
Olfr451-ps1 A G 6: 42,801,104 D121G probably damaging Het
Pcdhac2 T A 18: 37,146,189 C741S probably benign Het
Pcx A T 19: 4,601,730 N45I probably damaging Het
Peak1 A G 9: 56,258,898 V582A probably damaging Het
Plcxd3 G T 15: 4,516,736 R74L probably damaging Het
Ptpn21 G A 12: 98,688,530 A726V probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rimbp3 T C 16: 17,209,105 V131A possibly damaging Het
Rrp1b A G 17: 32,057,189 K570R probably benign Het
Serpinb1a A T 13: 32,845,737 F167L probably damaging Het
Slc12a1 T C 2: 125,228,816 L1076S probably damaging Het
Sspo A T 6: 48,448,519 T25S probably benign Het
Syvn1 G A 19: 6,047,941 R3H probably damaging Het
Tead2 A G 7: 45,228,742 E280G probably benign Het
Tmem263 T A 10: 85,114,567 V74E possibly damaging Het
Tmem38b T A 4: 53,854,332 L188Q probably damaging Het
Tmod4 C T 3: 95,125,860 T55I probably damaging Het
Tmprss12 A T 15: 100,282,265 E62V probably benign Het
Trim27 G A 13: 21,180,610 C39Y probably benign Het
Vmn2r110 A G 17: 20,596,228 L11S probably damaging Het
Vmn2r125 A G 4: 156,350,078 Y53C probably damaging Het
Vmn2r65 A T 7: 84,947,609 F79L probably benign Het
Vps13a A G 19: 16,749,845 probably null Het
Zdbf2 A G 1: 63,305,983 T1174A probably benign Het
Zfhx4 T G 3: 5,243,867 S718A probably damaging Het
Zfp78 A G 7: 6,373,214 T41A probably benign Het
Other mutations in Ctnna3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Ctnna3 APN 10 63566833 missense probably damaging 1.00
IGL00823:Ctnna3 APN 10 63537543 missense possibly damaging 0.68
IGL00963:Ctnna3 APN 10 64945949 missense probably damaging 1.00
IGL01388:Ctnna3 APN 10 63504107 missense possibly damaging 0.67
IGL01655:Ctnna3 APN 10 64873170 missense probably benign 0.01
IGL01783:Ctnna3 APN 10 63820469 missense possibly damaging 0.91
IGL01909:Ctnna3 APN 10 63504131 missense probably benign 0.11
IGL02160:Ctnna3 APN 10 64250698 missense probably benign
IGL02267:Ctnna3 APN 10 64945998 missense probably benign 0.20
IGL02524:Ctnna3 APN 10 64260826 missense possibly damaging 0.68
IGL02707:Ctnna3 APN 10 63504065 missense probably benign
IGL03165:Ctnna3 APN 10 64945941 missense probably damaging 0.98
Bipolar UTSW 10 64873207 missense probably damaging 0.96
Catatonia UTSW 10 64585995 missense probably benign
hebephrenia UTSW 10 64260935 missense probably benign 0.17
multiple UTSW 10 64250768 missense probably damaging 1.00
PIT4687001:Ctnna3 UTSW 10 64834606 missense probably damaging 1.00
R0345:Ctnna3 UTSW 10 63566840 missense probably benign 0.00
R0387:Ctnna3 UTSW 10 64586130 missense probably benign 0.00
R0523:Ctnna3 UTSW 10 64675909 missense probably damaging 0.97
R0647:Ctnna3 UTSW 10 63820424 missense probably benign 0.00
R0676:Ctnna3 UTSW 10 64409261 missense probably benign 0.20
R1102:Ctnna3 UTSW 10 64585995 missense probably benign
R1521:Ctnna3 UTSW 10 64959842 missense probably benign 0.22
R1700:Ctnna3 UTSW 10 63852772 missense probably damaging 1.00
R1874:Ctnna3 UTSW 10 63504107 missense possibly damaging 0.67
R1995:Ctnna3 UTSW 10 63820364 missense probably damaging 0.98
R2088:Ctnna3 UTSW 10 64873207 missense probably damaging 0.96
R2198:Ctnna3 UTSW 10 65002745 missense probably benign 0.00
R4056:Ctnna3 UTSW 10 65002568 missense probably damaging 1.00
R4208:Ctnna3 UTSW 10 64959778 missense probably benign 0.22
R4440:Ctnna3 UTSW 10 64260935 missense probably benign 0.17
R4568:Ctnna3 UTSW 10 63852809 missense possibly damaging 0.56
R4594:Ctnna3 UTSW 10 64586079 missense probably benign 0.32
R4835:Ctnna3 UTSW 10 63581944 missense probably benign 0.01
R4849:Ctnna3 UTSW 10 64873315 missense probably damaging 1.00
R5682:Ctnna3 UTSW 10 64873306 missense probably damaging 0.96
R5777:Ctnna3 UTSW 10 64675885 missense probably benign
R6414:Ctnna3 UTSW 10 64260865 missense probably benign 0.35
R7210:Ctnna3 UTSW 10 64250768 missense probably damaging 1.00
R7220:Ctnna3 UTSW 10 64834589 missense probably benign 0.04
R7680:Ctnna3 UTSW 10 64487550 missense probably benign
R7934:Ctnna3 UTSW 10 64585968 missense probably damaging 1.00
R8006:Ctnna3 UTSW 10 63582011 missense probably benign 0.02
R8415:Ctnna3 UTSW 10 63504130 missense probably benign 0.05
Z1088:Ctnna3 UTSW 10 63581978 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- CAAAACATGGATGTATGTGTGCATC -3'
(R):5'- CATGACTTGAACTGGGTGGATC -3'

Sequencing Primer
(F):5'- GGATGTATGTGTGCATCAAATAAATC -3'
(R):5'- GGATCTTTTTCTTGGCAGAGC -3'
Posted On2020-07-28