Incidental Mutation 'R8272:Rimbp3'
ID 637808
Institutional Source Beutler Lab
Gene Symbol Rimbp3
Ensembl Gene ENSMUSG00000071636
Gene Name RIMS binding protein 3
Synonyms RIM-BP3, LOC239731, LOC385766
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock # R8272 (G1)
Quality Score 212.009
Status Not validated
Chromosome 16
Chromosomal Location 17208603-17213982 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 17209105 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 131 (V131A)
Ref Sequence ENSEMBL: ENSMUSP00000127909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169803]
AlphaFold Q3V0F0
Predicted Effect possibly damaging
Transcript: ENSMUST00000169803
AA Change: V131A

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127909
Gene: ENSMUSG00000071636
AA Change: V131A

DomainStartEndE-ValueType
coiled coil region 25 56 N/A INTRINSIC
coiled coil region 84 145 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
coiled coil region 395 431 N/A INTRINSIC
coiled coil region 547 610 N/A INTRINSIC
low complexity region 688 701 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
SH3 825 888 7.58e-8 SMART
low complexity region 913 924 N/A INTRINSIC
FN3 980 1052 2.21e-3 SMART
FN3 1073 1160 1.91e1 SMART
low complexity region 1236 1243 N/A INTRINSIC
SH3 1423 1487 5.08e-2 SMART
SH3 1539 1602 5.97e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice homozygous for a null mutation display infertility with impaired spermiogenesis and defects in sperm head and flagellum morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931422A03Rik G A 2: 104,026,154 R21C unknown Het
4933407L21Rik G T 1: 85,931,397 E90* probably null Het
Abca15 A G 7: 120,407,442 Y1643C probably damaging Het
Adtrp G T 13: 41,816,154 A123D probably damaging Het
Asmt A T X: 170,672,725 D20V possibly damaging Het
BC067074 A T 13: 113,368,355 D1979V Het
Bid T C 6: 120,900,215 E55G probably damaging Het
Brd3 A G 2: 27,461,713 V176A probably benign Het
Btnl2 G T 17: 34,356,301 probably null Het
Card11 A G 5: 140,890,039 S562P probably damaging Het
Casp8 T G 1: 58,833,742 M259R probably damaging Het
Ccin G A 4: 43,984,064 R157H probably damaging Het
Cfap45 G A 1: 172,527,839 R18Q possibly damaging Het
Chuk A G 19: 44,103,736 I41T possibly damaging Het
Col28a1 G A 6: 8,154,175 P333L possibly damaging Het
Ctnna3 T G 10: 65,002,598 V818G probably damaging Het
Cyp4f18 G T 8: 71,989,091 L456M probably benign Het
Ddx50 A G 10: 62,621,477 V598A probably benign Het
Dhrs7b C A 11: 60,851,754 Q91K probably benign Het
Dnah11 T A 12: 118,111,017 T1367S probably benign Het
Fam98b T A 2: 117,262,854 C183S probably benign Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Fbxw15 A C 9: 109,559,760 S194A probably benign Het
Flrt3 G T 2: 140,660,697 P337Q probably damaging Het
Gm12695 A G 4: 96,723,946 Y527H possibly damaging Het
Gramd1b T C 9: 40,304,524 T677A probably benign Het
Grm8 A T 6: 27,363,282 S745T probably damaging Het
Kctd8 T C 5: 69,110,460 K436E probably benign Het
Klf5 G T 14: 99,302,104 A318S possibly damaging Het
L3mbtl3 C T 10: 26,303,668 V505M unknown Het
Letm2 A G 8: 25,586,656 L310P probably damaging Het
Lrrc16a T G 13: 24,036,579 H1054P probably benign Het
Lrrc4 T C 6: 28,662,193 H174R unknown Het
Myh11 T C 16: 14,218,854 S995G Het
Myh7b A T 2: 155,632,904 E1787D probably damaging Het
Myoc T C 1: 162,639,426 S55P probably benign Het
Naaladl2 T C 3: 24,058,202 Q572R probably damaging Het
Nanog T A 6: 122,711,777 S131T probably benign Het
Nifk A G 1: 118,332,404 K230E probably benign Het
Nlrp10 A G 7: 108,925,896 S126P probably benign Het
Npc1l1 T A 11: 6,229,327 K28* probably null Het
Olfr1454 G A 19: 13,063,431 V7M possibly damaging Het
Olfr451-ps1 A G 6: 42,801,104 D121G probably damaging Het
Pcdhac2 T A 18: 37,146,189 C741S probably benign Het
Pcx A T 19: 4,601,730 N45I probably damaging Het
Peak1 A G 9: 56,258,898 V582A probably damaging Het
Plcxd3 G T 15: 4,516,736 R74L probably damaging Het
Ptpn21 G A 12: 98,688,530 A726V probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rrp1b A G 17: 32,057,189 K570R probably benign Het
Serpinb1a A T 13: 32,845,737 F167L probably damaging Het
Slc12a1 T C 2: 125,228,816 L1076S probably damaging Het
Sspo A T 6: 48,448,519 T25S probably benign Het
Syvn1 G A 19: 6,047,941 R3H probably damaging Het
Tead2 A G 7: 45,228,742 E280G probably benign Het
Tmem263 T A 10: 85,114,567 V74E possibly damaging Het
Tmem38b T A 4: 53,854,332 L188Q probably damaging Het
Tmod4 C T 3: 95,125,860 T55I probably damaging Het
Tmprss12 A T 15: 100,282,265 E62V probably benign Het
Trim27 G A 13: 21,180,610 C39Y probably benign Het
Vmn2r110 A G 17: 20,596,228 L11S probably damaging Het
Vmn2r125 A G 4: 156,350,078 Y53C probably damaging Het
Vmn2r65 A T 7: 84,947,609 F79L probably benign Het
Vps13a A G 19: 16,749,845 probably null Het
Zdbf2 A G 1: 63,305,983 T1174A probably benign Het
Zfhx4 T G 3: 5,243,867 S718A probably damaging Het
Zfp78 A G 7: 6,373,214 T41A probably benign Het
Other mutations in Rimbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Rimbp3 APN 16 17209743 missense probably benign 0.01
IGL00786:Rimbp3 APN 16 17211688 missense probably damaging 0.99
IGL01411:Rimbp3 APN 16 17211094 missense probably damaging 1.00
IGL01434:Rimbp3 APN 16 17211702 missense probably benign 0.13
IGL01895:Rimbp3 APN 16 17211436 missense probably damaging 0.99
IGL02322:Rimbp3 APN 16 17211615 missense probably benign 0.00
IGL02649:Rimbp3 APN 16 17209608 nonsense probably null
IGL03285:Rimbp3 APN 16 17213232 missense probably benign 0.16
PIT4581001:Rimbp3 UTSW 16 17210716 missense possibly damaging 0.76
R0279:Rimbp3 UTSW 16 17209453 missense probably benign 0.00
R0465:Rimbp3 UTSW 16 17211780 missense possibly damaging 0.86
R0605:Rimbp3 UTSW 16 17211699 missense probably damaging 0.99
R0674:Rimbp3 UTSW 16 17212737 missense probably benign 0.02
R1676:Rimbp3 UTSW 16 17211113 missense probably benign 0.13
R1780:Rimbp3 UTSW 16 17212632 missense probably benign
R1946:Rimbp3 UTSW 16 17210427 missense probably benign 0.10
R2113:Rimbp3 UTSW 16 17209675 missense probably benign 0.00
R3847:Rimbp3 UTSW 16 17210299 missense probably benign 0.13
R3849:Rimbp3 UTSW 16 17210299 missense probably benign 0.13
R3850:Rimbp3 UTSW 16 17210299 missense probably benign 0.13
R4355:Rimbp3 UTSW 16 17209692 missense possibly damaging 0.56
R4646:Rimbp3 UTSW 16 17213098 missense probably damaging 0.99
R4669:Rimbp3 UTSW 16 17209189 missense possibly damaging 0.88
R4732:Rimbp3 UTSW 16 17210601 missense possibly damaging 0.94
R4733:Rimbp3 UTSW 16 17210601 missense possibly damaging 0.94
R5025:Rimbp3 UTSW 16 17209807 missense probably damaging 0.99
R5039:Rimbp3 UTSW 16 17213331 missense probably damaging 0.99
R5177:Rimbp3 UTSW 16 17209917 missense possibly damaging 0.85
R5311:Rimbp3 UTSW 16 17210844 missense probably benign 0.00
R5942:Rimbp3 UTSW 16 17211888 missense probably benign 0.00
R6063:Rimbp3 UTSW 16 17210917 missense probably damaging 1.00
R6092:Rimbp3 UTSW 16 17212270 missense probably damaging 1.00
R6126:Rimbp3 UTSW 16 17212276 missense probably benign 0.25
R6288:Rimbp3 UTSW 16 17212908 missense probably benign 0.22
R6446:Rimbp3 UTSW 16 17212929 missense probably benign 0.00
R6773:Rimbp3 UTSW 16 17209015 missense probably damaging 1.00
R7017:Rimbp3 UTSW 16 17209746 missense probably benign 0.04
R7043:Rimbp3 UTSW 16 17211108 missense probably damaging 1.00
R7048:Rimbp3 UTSW 16 17210326 missense probably benign 0.20
R7378:Rimbp3 UTSW 16 17211204 missense probably benign
R7440:Rimbp3 UTSW 16 17213201 missense possibly damaging 0.78
R7788:Rimbp3 UTSW 16 17212704 missense probably benign 0.00
R7879:Rimbp3 UTSW 16 17211046 missense possibly damaging 0.71
R8071:Rimbp3 UTSW 16 17210863 missense probably benign
R8419:Rimbp3 UTSW 16 17213022 missense probably damaging 0.97
R8819:Rimbp3 UTSW 16 17210907 missense probably benign 0.17
R8830:Rimbp3 UTSW 16 17209006 missense probably damaging 0.98
R8936:Rimbp3 UTSW 16 17213020 missense probably benign
R8982:Rimbp3 UTSW 16 17209647 missense probably benign 0.11
R9365:Rimbp3 UTSW 16 17208756 missense possibly damaging 0.93
Z1176:Rimbp3 UTSW 16 17209474 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGCGGCCACAATGACAAAG -3'
(R):5'- TAAGGAATAGCTGGCGCTCC -3'

Sequencing Primer
(F):5'- TTTCGCTACCCAGACGCG -3'
(R):5'- AATAGCTGGCGCTCCACGTC -3'
Posted On 2020-07-28